Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BOI2
Systematic Name YER114C
Alias BEB1
Description Protein implicated in polar growth, functionally redundant with Boi1p; interacts with bud-emergence protein Bem1p; contains an SH3 (src homology 3) domain and a PH (pleckstrin homology) domain
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BOI2	6320960 upstream sequence, from -1000 to -1, size 1000
TGACAGGATGATTGAATTGTTGCTACAGGGCGCGTGTGACCCAAATAAGCAGCAGAATTA
CCTTCAGGGGATGAGTCCAAGTAGGAAGAAGAAAACCCACGTTAAGAAATTTTTGAAAAA
GCAAAAAAAATCAAGGAAACCAATCACTCTGGAGCATGGTTGCTTGTCAGGACCCGTGAC
TCTACGTTTCGGAAATTTTGCAGGAATCAGAGATTTGAGAGGTACCAGGTGCCCGCTCCA
CGGCATAAAACATGGTGTCCATCCAAAACCCGGGGAGAGGTGTGCATGTCAGCAAGCTAC
CCTCTTTCCAAGTCCACTAGCTCGGTTTAGTTGTGACCAGTCTGCTGTACTTGGTTGCGC
TGCCTCCTCCACACGGGTCTATGACAGTATAGCCGATGAGTTTTCATCCCTATATTTTTA
AACACAGGAGAAACAATTCCATAAATAAACTTTGTAAGATAACTAAATTATAGGTCCCTT
TTCCATGTAGCTTCTCATCGCAAGATGCATAGGGTAGTAAACAAATATTTCGCTAAAAAG
GTGATTCTCTAGTCACGTGGTGCCTTTTTTTCCCATCGTTCTAGATCGATGCGGTATGAA
CGAAGAAGGAGACCTTCTTTTTTTTTTTTAAAAAAAAACAAAACTTATCACAGCCGCTAT
TCAAAATGCTCAGATTGATGAGGACAAATTCGTCAAGAAAGTAAGGTCTCCCTATTTAGA
AGCGTTGAAAAAAGCTGGTTTTAATATTTAGTGTTAGACTAGCCATATTTACTCTTTCCT
TTTAAGCGATAGTTAGCCCCACGATAAAACTTAGCAGTTTTTAAAGACAACAGATATTAA
AGTTGCTTTTAACACTATTTGCGTAATTCCCTTCTGCTTACACTTTTTTTTAGAGTGGTC
AAAAAGACTGTAACTGCTTTTTCAGTTTTAACTTTTCATTTTTAGCCACATATTTATTGA
ATCATACCAACTTCTCCGCAAAAAATTTGAACATATAAAG
Chromosomal Coordinates Chr V from 393712-390590
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator