Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NUP157
Systematic Name YER105C
Description Abundant subunit of the nuclear pore complex (NPC), present on both sides of the NPC; has similarity to Nup170p; essential role, with Nup170p, in NPC assembly
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NUP157	6320952 upstream sequence, from -1000 to -1, size 1000
CACTTTGCGGCAAAAATCTTTTCTTTTGATGGTTTGTCTCTATAATACTATCAATTTCAA
TTGTTAAGTCTTCAATGTTTTCCTTCCTTTTCTGTTTATTAGTGTAGTCAATATTATTGG
GTATCAGTAATTGTCCTATTGGAAAATATTCATAATGCTTCTCTTGTTCTTTAAGTAGAA
TATTCTCCATTTTCCACGACTCATCAATTGCGGAATACACATATTTATTATAGCAACTAA
GGCGGAGATTTTCATTCCAGTTTTCACTCATTTCCAACTCAAAAAGGAACCAAAGTCGTG
AATACTTGATATCTCTTCTATTTTCTGTGCTACAAAGACAATGATCACAGGCAATATCAT
TAAGTTCTCTATCGAAAATTTTCTCTTGTAACTTTTTCAAATTACTTCTTGTTAGACATT
CCGTTGCTTCTTCATTAGCGACATTATTTTGTAAATGCTGCGTATCTTTGTCTTCTTTTG
CTGCAACATTACCGGAGTTTTGCTTTGGTTTTACCGAGTGTTCTTTATGATAACTCGATA
AACAGTGTTCTTTTATGTTCTTCTTCGGTTGCTTTTCTGGGCTGGTATTGGATATCTTCC
TGCTCAAGAATCGGGAATATCTTTGGAGTTTATTTGGGAATTTGAGATAGTTTGTGTCTT
TATTTGAAATTGTTCTTTTTTCCCTCATTTTTTTTTCAGGAAACAAAAAAATTCTCTGAA
AATGCTTTTGCTAGTAAATAAATATGGCTATGTTTCCATTGTTGAACTTTCCATGAACGT
CTGGAGATTATTCTATTATTATAGTATTTGCTGATTAAAGTATTATAAAATTAGTGACAC
AAAATAGAAAGTATTACCCGACTTTGGAGAGGAAAGATTTCTAATGAATAATTTCCATCT
GAATTTTGAATGGCTTTATAAATCAATAGAAGAAATTAAGAATAAAATCTGTTTGTAGGA
GAAACATTTCACAAAAACTACAGCTCGGATTTCAATTGTG
Chromosomal Coordinates Chr V from 372013-367838
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator