Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PTC2
Systematic Name YER089C
Description Type 2C protein phosphatase (PP2C); dephosphorylates Hog1p to limit maximal osmostress induced kinase activity; dephosphorylates Ire1p to downregulate the unfolded protein response; dephosphorylates Cdc28p; inactivates the DNA damage checkpoint
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PTC2	6320934 upstream sequence, from -1000 to -1, size 1000
TAAGAAATATAACCAATAGCACCACCACTTAATTTCGGTAAACCAGGAACATTTTCGGCT
ACTTTAAAGGTAGACATCTCCTTTTCCAAAATTTCCAAAGGATCTGTTTCAATGCCTTCA
GTAGGACCGGTTTTGATGGTCTTGCGTGGCGAGATACCTATGAATGAATAACGATCTAAT
TCATTATTTGTCTTAGCACTTTCCAACAGAAATGATTCCTTTCTATCAGGGTTGTTCAAT
TGTGCCAATTTTAGATATGCCACGTGAGGAGTCAGATCCAATGATGGCAAATACGCATAC
ACGGGATACATATTTATGGAACTATCGTCATTTTGCTGCTGTAATTGCTTTAGAGAGTCA
ATATCCGGTTGAATTTTGATGGAAGCGGTCATTTTTTGCCTTTTTTCCAATCAGAATATC
AGTGCTAATTATCGATTGTGGCCTCGGTTTTAAAGTGATGATTGCCTTCTGCTACGATGG
ACCATAGCCCTTTAGTCATGTTAATATATCAAAATCTAACAATACTTCGATGAGTGAAAA
ATCGTAATGAGTCAGCAAATCACTGTGTACGTTAATGCCTTTAACAACTTTTTTTTTCCC
ACAAACTACTTCAACGATTGAAAGGATTATTCTAAAAAAAAAAATATCATGCTGATAAAT
GGAAGGGGATGGTAAAACAAAGAAAACCAGCCAATTCGGATTCTGACAGAGCAAATTGAA
ACTGGATATTATAGTGCTAAGTATATAGACTTCTGTTTTGTTCTTTAAAACTAAATAAAA
AAAATTCACCCTCCTCCCCACGGAATAAAACTACAACAAGTTCTGTTATCAAGGACAATT
AGTGTATATTAGTTGTTGTAACATTTTTTACTTTCTCTTTTTTTTTTTCATTGATTAATT
ATAACTATTCGTTCGAGATAGTAGTTTTCCGATTAATAACATCCCTAGGATTTTGACTAT
TCCATTGTTGTATAAAATATAGAGAACCAGAAAAAGAAAA
Chromosomal Coordinates Chr V from 337340-335946
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator