Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RNR1
Systematic Name YER070W
Alias CRT7, RIR1, SDS12
Description Major isoform of the large subunit of ribonucleotide-diphosphate reductase; the RNR complex catalyzes rate-limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNR1	6320914 upstream sequence, from -1000 to -1, size 1000
GGGTTATGGAGAGTATGCTGGTATCCCTGAAAATAAAATTATTGGTGTCTGATCACTGTG
TATAGTAGATCTGCAGCTCAGTCACATGAGACATTAACGTATATAAATATATAAATATAT
ATATATCCATTAAATAACGAAGTAGGACATGGTCTAAAAATAGTGCTTCTCATGTATTGA
TTTTGAGTAGCCATAAGAATAATTATTGATTTCAAGATCTTTGATCTCCTTACATCCAAA
ATTATAATACCACTTTATGGTATCACGACATCACCACAACAGAGAAGGATTGCCGCATTT
GGATATCGTAAACAAAGGCGTTACCATAGAAATGTACTGATTGGCAGAATTACTCTTCAG
GAGAATCTTTCATACAAAGGAATTCCATTGGGGAAAATCTCGTTACCAAGTCAATGCTGA
ACTTTCTATGGCCTTTGTTTACTATCGTTAATTATTTTACGACCACTTCTGGGTAGAAAT
ATTTCGTAGCCCTGGAACGAGCTTGTTTACGCGTTTTATCCCATTATATGGCACCCAAAT
CAAATTTAAAAAGAAAAAACGCGTAAACAGTGTCGGGTAAGTTCATCCTCTGTTACTTTA
ATTGCTTCTTTTTTTGAAATTCTAAGTAAACGCGTCATTTTGATCCTCAGGACACAGAAA
TCCTTGCAGAATCTTATTGGGTGTTGAATAGAGGACGCGTAAAAACGATATGGAAATTTT
TTTCATATAGTGTAGAAAGAATAGGTTGGCGTAGGTAGTTTCGTGTTTGATAGAAACCTC
CAACAAAGTCTGCAGCTCACGTTTTAGAATAACAAGTTTAGAGTTTATCTTGTTGCCTTT
GTTAAGTCAGTACCATTGAATAAAAATTATATAAAGGAGCTAATATTTCATTGTTGGAAA
ATTACTCTACCATAATTGAAGCATATCTCATCCTTTTCATCCTTTTCAACGCAAGAGAGA
CACCAACGAACAACACTTTATTTGTTGATATATTAACATC
Chromosomal Coordinates Chr V from 298950-301616
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator