Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HXT13
Systematic Name YEL069C
Description Hexose transporter, induced in the presence of non-fermentable carbon sources, induced by low levels of glucose, repressed by high levels of glucose
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HXT13	6320766 upstream sequence, from -1000 to -1, size 1000
TGCTGCAATTTGCTATTTCACAAAATGTCTATAATCTGAAGTGCTGAGAAACCCGGACAT
TTTAACGCGAATTCTATAATTTTAGAATGGAACAAAATAGTAATGGTACGAGCTCTGGTT
GTCGTGTCCTTCTATGGCACCCTTTTACCAATTTAATAATGTCTAGGATTTATCGCTGTA
CTGCCAAATGCTTCACAACGAAGGGGCAAAGTGTTGCAAAAGCACCTTCCTTACTAAAGG
CAGTTTGAAATACATTCAATAAAAAGTAACCTGTGCCTTCAGAGAAACATACTATTGACA
ATCATTTGTCGTGTTCCTTTCCTTGAACATAAGCCTGAAAACAACAATTTTTTTTTGTCT
GTAGGACTACATTTTAGAGTTTCAGTTGATGTCTGCTTGTTGCGATGGCTAGCCAATCAC
CTAATCGTTGTCGACATCGTTTATTGAACTATGCAGACAGTTAGTTTAATTTAACTTCAA
GGGGCGCGCACCGGAGTTAAAACTAAAAAATATTAAATGAGAAATGTGGGGGTGGGGTAT
GCGTTTCATGTGCGTGGGGAAAGTATAATCATCAGTTCAGGAACCAAGGAACAAAGGCAC
CACGCGGCGTGGGATGCTTTCTTGTGCGGTGGGTTGTAGGTAGGCAAGATGGTGAGGTTG
AATCCGCCCTAGCCCGGCATGACGTAGATATTCGAGGATAATATTAGATAATAATATCCT
TTAACTCCTGGTTTACGGATATTCAGAACCCAATGAAAAGACAGTACTCTCTAGGGTTGA
TTCCCCTGGATATATGCGCAAATGAACATAGTGTTTGTCGAAATTTATCGTTCAAGGGTG
TGAGGTCGTATCTTCCAGCAAGTAATTGCAACTAAAAAGTCATATAAAAGAGGCAGATGA
AACAGAGTTGTTTGAGGTAAAATTTCTATTCCTACTTTGCACGTAAGGCATAACAATCAA
AAAAAGAAAAAAGAAACAAAAGTTAAACCAAAAAAAAAAA
Chromosomal Coordinates Chr V from 23231-21537
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator