Yeastract IST IBB-BSRG INESC-ID
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HXT13
Systematic Name YEL069C
Alias HLT1
Description Hexose transporter, induced in the presence of non-fermentable carbon sources, induced by low levels of glucose, repressed by high levels of glucose
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HXT13	6320766 upstream sequence, from -1000 to -1, size 1000
TGCTGCAATTTGCTATTTCACAAAATGTCTATAATCTGAAGTGCTGAGAAACCCGGACAT
TTTAACGCGAATTCTATAATTTTAGAATGGAACAAAATAGTAATGGTACGAGCTCTGGTT
GTCGTGTCCTTCTATGGCACCCTTTTACCAATTTAATAATGTCTAGGATTTATCGCTGTA
CTGCCAAATGCTTCACAACGAAGGGGCAAAGTGTTGCAAAAGCACCTTCCTTACTAAAGG
CAGTTTGAAATACATTCAATAAAAAGTAACCTGTGCCTTCAGAGAAACATACTATTGACA
ATCATTTGTCGTGTTCCTTTCCTTGAACATAAGCCTGAAAACAACAATTTTTTTTTGTCT
GTAGGACTACATTTTAGAGTTTCAGTTGATGTCTGCTTGTTGCGATGGCTAGCCAATCAC
CTAATCGTTGTCGACATCGTTTATTGAACTATGCAGACAGTTAGTTTAATTTAACTTCAA
GGGGCGCGCACCGGAGTTAAAACTAAAAAATATTAAATGAGAAATGTGGGGGTGGGGTAT
GCGTTTCATGTGCGTGGGGAAAGTATAATCATCAGTTCAGGAACCAAGGAACAAAGGCAC
CACGCGGCGTGGGATGCTTTCTTGTGCGGTGGGTTGTAGGTAGGCAAGATGGTGAGGTTG
AATCCGCCCTAGCCCGGCATGACGTAGATATTCGAGGATAATATTAGATAATAATATCCT
TTAACTCCTGGTTTACGGATATTCAGAACCCAATGAAAAGACAGTACTCTCTAGGGTTGA
TTCCCCTGGATATATGCGCAAATGAACATAGTGTTTGTCGAAATTTATCGTTCAAGGGTG
TGAGGTCGTATCTTCCAGCAAGTAATTGCAACTAAAAAGTCATATAAAAGAGGCAGATGA
AACAGAGTTGTTTGAGGTAAAATTTCTATTCCTACTTTGCACGTAAGGCATAACAATCAA
AAAAAGAAAAAAGAAACAAAAGTTAAACCAAAAAAAAAAA
Chromosomal Coordinates Chr V from 23231-21537
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator