Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SIT1
Systematic Name YEL065W
Alias ARN3
Description Ferrioxamine B transporter, member of the ARN family of transporters that specifically recognize siderophore-iron chelates; transcription is induced during iron deprivation and diauxic shift; potentially phosphorylated by Cdc28p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIT1	6320770 upstream sequence, from -1000 to -1, size 1000
GTGCAGACTAATGAAAAAGACCCCAGACCCATCTCCACCTTTTGCAAGCACGAAGAACGT
AGGCATGTCAAACGAAGAACCGGAAAAAATGGTTAACGATCGAATTGTGGTGAAGGCCAT
CGAGCCAAAAGATGAGGAAGCCTGGAACAAACTGTGGAAGGAGTATCAGGGTTTCCAAAA
AACGGTTATGCCTCCGGAAGTAGCCACCACTACCTTCGCAAGGTTTATAGACCCTACGGT
CAAACTATGGGGTGCTCTAGCCTTTGACACCGAGACCGGCGATGCAATTGGCTTTGCACA
CTACCTGAACCATTTGACGTCGTGGCATGTCGAAGAAGTTGTCTACATGAATGACTTATA
TGTCACTGAACGCGCAAGAGTCAAAGGCGTAGGTAGAAAGCTCATAGAATTTGTATACAG
CCGTGCCGATGAGCTCGGTACGCCTGCAGTGTACTGGGTTACAGACCATTACAATCACCG
CGCACAGTTGCTGTACACCAAAGTGGCTTACAAGACAGATAAGGTTCTTTACAAGAGAAA
CGGATACTGAAACCGCTGTGTAATGTAGACTACTGTGTATAGAGATAACTCTAGCTTCTA
TAGGCTCACTTGCGAAGCTTTTTTCCCACTTTTTCCCAGTGAAATAGTTTCTTATTGGCT
TTTCATAGTTTGTTCTCCGATTTAATCGCAAGCGCCGTACGGCGCAGGCACAGAATGACT
TGCAGCTTAATCCAGGTGCATTTTAAGAAACTTATCTGCTGGGAAGACCCCGAAGTTCAT
CGTTTACAATGTGCCGTAAAGAACACATTTGAGGGTGCAATCTGGTTCGTCTTTTGCCAT
AATTAGTAGTGCTCATCCGTGATCCTTTAATTTACTTTTGTGATGCGATGATTTGCAGAT
ACTATATAAGCAATGGACACCGTCCATCACCGATGAGGCTAGAACATCGTAGTGCTTTGT
AAAAGAACTGTTAAAGACCCAGTACGAAAATTTTTCCATA
Chromosomal Coordinates Chr V from 27657-29543
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator