Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SOM1
Systematic Name YEL059C-A
Description Subunit of the mitochondrial inner membrane peptidase, which is required for maturation of mitochondrial proteins of the intermembrane space; Som1p facilitates cleavage of a subset of substrates; contains twin cysteine-x9-cysteine motifs
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOM1	7839166 upstream sequence, from -1000 to -1, size 1000
AATCAATCTTTTCGTGTTCAATCAGCTTGGCCAACTCAACACGAAATTCTTCAAAATTAG
TGGCAAAAGAGGCCGCATTGGCCAACTGCATGGCATATGGCTCCCATGTGGCCAAAAGCA
TCGATCCGTCTGGTTCCACGATCTTGACCCCGTTGTCCTGGTATGGGTTGTGCGACGCCG
TGATCATCACCCCCACATACTGACCCTGAAGCTTCAGCGACCTGAGAACCGCCAGTATAC
CAGTACTGAACATCACCGTATCCAAATTCTTGGCCAGCGTTCTGAATCCGGCCGTACCGT
AACTGAACTGCACATTCTTTGTGCGGCACGTGTCATCGTAGAGTTTGCACAATTGCTCGT
AATCAACCTTCATCGTCTCTAAGCTTACTGCTGACCTTTGCCTTGGTCCTTGTACTTGTC
TCGATTGCTGAAACCATTAACGGTTTTTTGTTCTTACTTAATCTTTTTTTTCCCGACGAC
GCAAAATGTCAGAAAAGATATAAATAGAGCAACGTTTCCTGCTACATGAAACACGCTGGC
ATATAGAAGAACTTCAACGAGCGAGGCTCTCTGAACAATCTGCTAATCGTGCAAGTAAGG
GTTCTCGTGACAGTTCACCGTGTATAAACAGATAAACAGATAAACAGTCAGATATGCTTA
ATTTTTAACTGTAGGCTGTGCCGACATGCCATTTTATGCGGCTCACTTCTAACAAAAGTG
ACCATGACGCACAAGCAAGCAAACAGCCAAGTAAGGAAGCAGACAGCTTCACAGCACACA
CACACCGTTGTGTACGAAAATCCTCTGCAGAAGAGTGTATATGCCACTCATCCACACTTC
CGCAGCGCAGTACGTAATGCGGTATCGTGAAAGCGAAAAAAAAACTAACAGTAGATAAGA
CAGATAGACAGATAGAGATGGACGAGAAACAGGGGGGGAGAAAAGGGGAAAAGAGAAGGA
AAGAAAGACTCATCTATCGCAGATAAGACAATCAACCCTC
Chromosomal Coordinates Chr V from 42624-42400
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator