Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CYC7
Systematic Name YEL039C
Description Cytochrome c isoform 2, expressed under hypoxic conditions; electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone-cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CYC7	6320796 upstream sequence, from -1000 to -1, size 1000
CCGCAAGATGTTGGCGTAAGACTGTGTTTCGGTTTTCTTTCCAGAAGTGTTGATGTCGAA
ATAACCATCTATATAAGAATTCAAATCCAACGAATCATGCGCAGGCGCGTTGGGATCCTG
AACATACCCGAACAGCAATTTCTGTGCCTTTACAGATCCACTAGAGTAGATAAACACACG
CTTCTTCCTCTTGATAAAGTCAATAGCATCTGCATAAACGGGCGCCTTAATCTGCCCAGA
TTCGTATCCGTGAGCCCAGACGTAGCCTTGCAACTGTTTCAAGATTGGATCCTTCACATC
CTTGGCCACCAACTCCAAAATATGCGCCTGCAACTGCTCCTTATTGTCGATGTGAAACTG
CGACAGAATGTTGGAAACCGGGGAGTCCCTTGTATCCTGTTGAACCAATTGCGGCACTTT
ATTCGTGAAATAAGGGAATAAAGTCTCCTTCACGAACGAGATCGGGCACACTGTCCCTTC
AATATCAAGCAAGTAAGTCGAGTAATTGTCTCCCATTTTTGGTATACGAGCTAGCAGGAC
CTTTTGCCCAATGACCATTCCATATTCATCCCACTCACCACCGTCATCGTTGGTATTATT
ATTATCATTCCGCTTGAAGAAAAAGAAACGAAAAAAGAAATGGATCAGCAGCCGGGTTAT
AGCGCCCCTTATTGAATTATTTTCCTTCGTGCCTTCTCTGAGAAGGGTCTGCAGTCCCCC
GCCGAGGGGTCTTTTCCCACCTTCTCAAAGCTAATAGCGATAATAGCGAGGGCATTTATT
CAAGTTCCAACTACTATAAGTGGCCGCAAGGGGCAAAGACAAAGGCACACAACATATATA
TATATCGTGTTGTGAAGCTCGAGAAGATTAGATCAGAATAGTTCTCTTTTTGTTGAGGTT
GAAACAAAATCAAAGACTTATACAAGAAGATCACATACAAGCATTTATTCACATTACTTT
AAGTAAACTTCAGTAAACTACATTACATCATAAACAAAAC
Chromosomal Coordinates Chr V from 79977-79636
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator