Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GCN4
Systematic Name YEL009C
Alias AAS101, AAS3, ARG9
Description Basic leucine zipper (bZIP) transcriptional activator of amino acid biosynthetic genes in response to amino acid starvation; expression is tightly regulated at both the transcriptional and translational levels
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GCN4	6320828 upstream sequence, from -1000 to -1, size 1000
AATATTGCCGTGTTCCGTTACCGGAGAACAATCGATGATGCCCCCATACCCCATACCCCA
TGCGTGGACGCACAAAGCACCCATACCTTTTACAATGCCGAACACCACCGGCATCTTGTA
AAAATTAGAATTATTTGTCCGGGCGTTGACAATGCCTTTCTTGACATACACACCGCCTCT
CCAAACGCCAATCTCCAGCCAATTAAATTGAACTGCTTTCGAAGATCTTCGGGGAATAAA
GTGCATGAGCATACATCTTGAAAAAAAAAGATGAAAAATTTCCGACTTTAAATACGGAAG
ATAAATACTCCAACCTTTTTTTCCAATTCCGAAATTTTAGTCTTCTTTAAAGAAGTTTCG
GCTCGCTGTCTTACCTTTTAAAATCTTCTACTTCTTGACAGTACTTATCTTCTTATATAA
TAGATATACAAAACAAAACAAAACAAAAACTCACAACACAGGTTACTCTCCCCCCTAAAT
TCAAATTTTTTTTGCCCATCAGTTTCACTAGCGAATTATACAACTCACCAGCCACACAGC
TCACTCATCTACTTCGCAATCAAAACAAAATATTTTATTTTAGTTCAGTTTATTAAGTTA
TTATCAGTATCGTATTAAAAAATTAAAGATCATTGAAAAATGGCTTGCTAAACCGATTAT
ATTTTGTTTTTAAAGTAGATTATTATTAGAAAATTATTAAGAGAATTATGTGTTAAATTT
ATTGAAAGAGAAAATTTATTTTCCCTTATTAATTAAAGTCCTTTACTTTTTTTGAAAACT
GTCAGTTTTTTGAAGAGTTATTTGTTTTGTTACCAATTGCTATCATGTACCCGTAGAATT
TTATTCAAGATGTTTCCGTAACGGTTACCTTTCTGTCAAATTATCCAGGTTTACTCGCCA
ATAAAAATTTCCCTATACTATCATTAATTAAATCATTATTATTACTAAAGTTTTGTTTAC
CAATTTGTCTGCTCAAGAAAATAAATTAAATACAAATAAA
Chromosomal Coordinates Chr V from 139763-138918
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator