Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name WBP1
Systematic Name YEL002C
Description Beta subunit of the oligosaccharyl transferase (OST) glycoprotein complex; required for N-linked glycosylation of proteins in the endoplasmic reticulum
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>WBP1	6320835 upstream sequence, from -1000 to -1, size 1000
TAAAAGTTCACTGTCACTTCTTTATAGCTGGCAATTATGAGGTTTTCTATGTTAATCGGG
TTTAATTTATTAACTGCCTTGAGCAGCTTCTGTGCTGCCATATCAGCTAATAATAGCGAC
AATGTCGAACATGAACAGGAAGTTGCGGAGGCGGTAGCGCCACCTTCTATTAATATAGAG
GTGAAATATGATGTCGTTGGGAAGGAATCAGAAAATCATGATTCTTTCCTTGAGTTTTAC
GCGGAGGATACCGCTACCTTAGCCTATAATGTTACTAATTGGGAAGATACTAATATCACA
ATTTTTGGTGTCAACGGAACAATTGTTACATATCCACATGGTTATCCTGTGGCGGACATT
ACAGGTGCGAGTATTGGGCCTTACGAAATGGAGGTCAACGGAACTTCAAAATTCGGGCAA
GACGTTACGTTAAATTTACCGGAAGGACAATACTTTTTAATCCCATTTTTATTAGCTTCT
AGGTTCGATGAAATCGTGAGAATTGCGGCACCACCAACCCTATTCGAAATTGTTAGCCCA
CCTATTTCCTTTTTCAACCCACAATTTTTATCAGTTCAGGTCATCTTTCTAGCCATCATC
GGAGGTGTAAGTTATTACTACATGAAGTCTAAAACAAATCAAAGACCTTCCAAGAAGAGT
GCCACTGTCAAAAAAGTTGATGAATCATGGTTGCCAGAAACCTATAAAAAATAAAAATGG
CGGAGTAAGATCTCTGGATGATGATAGGGGGCTCTCATTGTTTTATAGATACATATTAGT
ATACTACAATTAAAGATATCCCAATATCTACTTTCGATATTTTCAGGGCGGGTTATTGAA
TAATGCATTACCCTAAGCTACGCCTGAAAAATATCAAACACGCTTCTTGAAAAGAGAAAC
CTTTAAAGAGGTGTATAGTCAACTGAATTGGTTATAAAGTTGAATACTTTAACACAATTG
ACGGTGCAAATTTTGAATTATCCTTTTTTGATTATTTAGG
Chromosomal Coordinates Chr V from 150014-148722
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator