Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPP2b
Systematic Name YDR382W
Alias RPL45, YPA1
Description Ribosomal protein P2 beta, a component of the ribosomal stalk, which is involved in the interaction between translational elongation factors and the ribosome; regulates the accumulation of P1 (Rpp1Ap and Rpp1Bp) in the cytoplasm
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPP2B	6320590 upstream sequence, from -1000 to -1, size 1000
ATAATAGTTTTTTTCATTCACTTCACCATTGTTTCCCCGCGCCTTTGGTATAAATTTAGC
ATCTCTTCTAGCTTTCACTATGGTCTTGACCACATAAATAGACGCAATCCCGGCTGCAGA
AATGTATAGTAAATTCTTACTGTTGAAATCGCATTGGTAGTGTTTTCCTACTTTCGTCTT
CACTTTGGTTATATATATGGTGCAATCAAACTCTGCTTCAAGGGATAGGCCAATAAGGAA
ATAACCAAAAAAGAAGTCCGGGAAATAGAAAAAGATATCCAATGTTAGTTTAGGCTTTAC
GAATAGATGTTTCCCTATTTCTTTTACACATACCCTATATTTTGAAATGGATTTGACATT
GTATACTTAGTACGGCTCAAAGAATGAAATATTACTATATTTATCTCTTCATCTGCCTTG
ATTTTTTTATATGCAAGCAGGACGCTCGGGTTTGTAAGGAGGAAGATTGAAAAGGATGTC
TTCAACTAAAAGGCGAAGAAGGAAGCGACACATTTGTGATGCTTTGAGGTCAGTAATGTA
ATATATATATATATATATATATATATATATTATATAGTGTAACTGCTCTTATTTATCTTG
TCTATTCGAACCCAACAAAAAAGGCTGCAGTGGGAATCTGTTCATGTGGCTGTATCACAA
CCAAGGGCTACCGTTTAAGAATACTGGAGAGCTCTTGTCGTCTCTAATTTTATGATCACG
TGCCCATTCTAGTCATTACGCAGGTAATGCGAAAATTACAGTATGGATCGTGTAAAGTTA
CCAAGCAGAAAAATTGTAATAATTTTCTTTTTCCAAATTTTCTCGGTATCTGAAATTTTT
CATTTAAGAGATGATATTTGGACTTACTCTAAACTATTACTTTACGTATCTTTGATTTAA
CTTCCAGTTACAGATCGTTAAGGAATAGTCCGCGAATTTATTACCGCTTAAACTGATTAT
TTCAAATATAGAAAGTAATATCTATTAATCAACAACAGAA
Chromosomal Coordinates Chr IV from 1239492-1239824
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator