Yeastract IST INESC-ID IBB-BSRG
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPP2b
Systematic Name YDR382W
Alias L45, P2B, RPL45, YP2beta, YPA1
Description Ribosomal protein P2 beta, a component of the ribosomal stalk, which is involved in the interaction between translational elongation factors and the ribosome; regulates the accumulation of P1 (Rpp1Ap and Rpp1Bp) in the cytoplasm
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPP2B	6320590 upstream sequence, from -1000 to -1, size 1000
ATAATAGTTTTTTTCATTCACTTCACCATTGTTTCCCCGCGCCTTTGGTATAAATTTAGC
ATCTCTTCTAGCTTTCACTATGGTCTTGACCACATAAATAGACGCAATCCCGGCTGCAGA
AATGTATAGTAAATTCTTACTGTTGAAATCGCATTGGTAGTGTTTTCCTACTTTCGTCTT
CACTTTGGTTATATATATGGTGCAATCAAACTCTGCTTCAAGGGATAGGCCAATAAGGAA
ATAACCAAAAAAGAAGTCCGGGAAATAGAAAAAGATATCCAATGTTAGTTTAGGCTTTAC
GAATAGATGTTTCCCTATTTCTTTTACACATACCCTATATTTTGAAATGGATTTGACATT
GTATACTTAGTACGGCTCAAAGAATGAAATATTACTATATTTATCTCTTCATCTGCCTTG
ATTTTTTTATATGCAAGCAGGACGCTCGGGTTTGTAAGGAGGAAGATTGAAAAGGATGTC
TTCAACTAAAAGGCGAAGAAGGAAGCGACACATTTGTGATGCTTTGAGGTCAGTAATGTA
ATATATATATATATATATATATATATATATTATATAGTGTAACTGCTCTTATTTATCTTG
TCTATTCGAACCCAACAAAAAAGGCTGCAGTGGGAATCTGTTCATGTGGCTGTATCACAA
CCAAGGGCTACCGTTTAAGAATACTGGAGAGCTCTTGTCGTCTCTAATTTTATGATCACG
TGCCCATTCTAGTCATTACGCAGGTAATGCGAAAATTACAGTATGGATCGTGTAAAGTTA
CCAAGCAGAAAAATTGTAATAATTTTCTTTTTCCAAATTTTCTCGGTATCTGAAATTTTT
CATTTAAGAGATGATATTTGGACTTACTCTAAACTATTACTTTACGTATCTTTGATTTAA
CTTCCAGTTACAGATCGTTAAGGAATAGTCCGCGAATTTATTACCGCTTAAACTGATTAT
TTCAAATATAGAAAGTAATATCTATTAATCAACAACAGAA
Chromosomal Coordinates Chr IV from 1239492-1239824
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator