Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TRR1
Systematic Name YDR353W
Description Cytoplasmic thioredoxin reductase, key regulatory enzyme that determines the redox state of the thioredoxin system, which acts as a disulfide reductase system and protects cells against both oxidative and reductive stress
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TRR1	6320560 upstream sequence, from -1000 to -1, size 1000
GGCTCCACCCAATCACAAGTGGGGCCTCCCGGAGATGGTAAAAACAGCCAGCTGGGTACA
ATTTTATCTTGGATTGGCGCTTCCTTCTACGTAGGCGCACGTATCCCACAACTAATCAAG
AATTACAATAGAAAGTCTACAGACGGCTTATCTCCCTTCCTATTTGCTACTACACTACTC
TGCAATATCACGTATAATTTGAGCATCTTCACAAGCTGTAGATTTTTAGATAATCAGAAC
AAGAGGGAATTCATCGTGAATGAGTTGCCCTTTATATTTGGAAGTGCTGGAACAATTGCG
TTTGATTTGATATACTTCTACCAATACTATATCCTTTATGCAACTGATATGCAACTACGT
GAACTGGAAAGAGAACTATACAGTCCTGAAGAAGACAGTGCAGCGCAACTAGTGACAGAA
CGTACATCACTGTTGTCTGGTGAAACGCAAACATAGTTTTCCCTACGGAGTACTACCATT
TATATTTAAACAATGCACTCTGCTCTTGGGATAGTCCTTGCGAGACCCTTTTTTCCCAAT
AGGAATACTACGTTCGTACTCTGTGTAAAAGTACCCAACTATAGTTAGCGCCAGTTTTAC
GTAAAACCGTCTATGTCTTGTTTGCATTCGCAACAGCTACAAACACATATAGTTTGTCAC
ACTAATATTAATAATGAAAGTTATTATGTATTCACTGTGAACGCTTCAGTATACAGTACG
GCAGTAAGTGTTTCATTCTGTTCTGGATTAATAATCTTTCACTTTGCCTAGCCATTTGGG
GGCGGGTTTTGGCTGGGTTAGCTTCTCCTTAGTCATGGAGAAAAAAAATCGCCCGCAAGT
ATCTCGAAAAAGGAAAAAATGCCCACGCGTATAAGAGTGGACCCAACTGCTCGAGGTTTC
AAGAGCTTGTAGATTAATTTCTGTAGTTCAGTTATACTTGCCTACAAGTGCTATACAGCA
AATAGCGAACAGTACGAAAGTAAACATCATATTATCAATA
Chromosomal Coordinates Chr IV from 1183299-1184258
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator