Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PEX3
Systematic Name YDR329C
Alias PAS3
Description Peroxisomal membrane protein (PMP) required for proper localization and stability of PMPs; anchors peroxisome retention factor Inp1p at the peroxisomal membrane; interacts with Pex19p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX3	6320536 upstream sequence, from -1000 to -1, size 1000
TGTTAATCATTATCCATTTTTGCTTTGCCCTTGCCTTTTGCTTTGCAGCGTCTAAGTCGA
GTTTGGACATGATTGAAAATGGAGGCCTAAATAACAAAGCTAATTTCTGCTCCTTGGAAA
TGGTTTTAGGCTTTCTCACTAATTTGGTGTACTCCTTGATATTGCCGTCTTCATCAAGTT
CGATGACCGGCTCTTCCACATACTCATATTCGTCGTCGTCATTTTCTTCCTCGGAGTCCA
AGGAATCTGAAGAGTTGTCATTGATGTATGTATTAGTATTTGTGTCATCCAATCGTTGAT
TAAAAATGCTTTCAGGTCTTCCTTCGTCAAACATGTCGTTCACCCTATGCAATGGTTCAA
ATCTTCCGCCAATGCCGCCGTAAGAAATTGGGAATCCTGAAGTTTCAGTAAGTACTTCAT
GTCTTGCCTCATCAGGTGGCCTGACATAATCTTGGTCAGGCTGTTGTTGTTGGTAAGCTT
CCCTTTGCAACCTCTCCGCTAATTGTGCATCGGCATCTGAATCTACAGAGGTGGGCGCCA
TAGGAGTCGAATTAGACGGAGTAGGTGTGTTGTTACTGCTCAGTAAAGCAGCCCCACCAT
TTTCGAAAAACAATGATATGGCTGTGTTCAAGTTCCCGTCTGCCATTTCGATGAATTGAG
TGGCAATAGCAGCGTCATCAGCGCCAGTGATGGCCATAAATTCGTCTACTTTTCCCTCTG
ACATATAAAAGGTATGTTATTATTGCCACACGTCGTAGTCTATGCGTTTGTAGTGACACT
ATTGAGCGATCATAGCTAAGATGTCGTTAACAAGTAGTAGAGTTTGCGTGAATGTATGAA
TATTTCCCTTTTTCCTTAAAAATTCCTTGCATTTTGGTAATCGTGTGTAATGATAAGGGC
GTTATTCGACTTATATGAGCATGGGGTATATTATTGAGGTAGTTAATACTAGTCATCGTA
AAAGCAGAAGCACGAAACAAGGAGGCAAACCACTAAAAGG
Chromosomal Coordinates Chr IV from 1127595-1126270
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator