Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YDR316W-A
Description Retrotransposon TYA Gag gene co-transcribed with TYB Pol; translated as TYA or TYA-TYB polyprotein; Gag is a nucleocapsid protein that is the structural constituent of virus-like particles (VLPs); similar to retroviral Gag
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR316W-A_YDR316W-A	YDR316W-A upstream sequence, from -1000 to -1, size 1000
TGTAGAAAAATACTTGCAATCAAGTATTAGAAAGAGAATGGAATCATTCGAAAAAAAAGA
CGATATGGCATCTAAAAAAGAACTTGAGCCAGTACCTCCTGTAAGTAAAAGTTAACATAT
TTATTCATACCAATGAATTTTATACAGGCTTAGAATCGTGTAAATATTTCAGTAAGCAAG
TTAAAATGTGATCTAAAACCCCTTAGGTAGTTCTCCTTACTTCTAAAGTGATCATACTGA
CCATATGTGACGTAACGACGCTATTATTAACAATCCAAAAATTGCGTCACTGGGAAAAAA
TAAAAATGCGAACTCTGTGGATCGAACACAGGACCTCCAGATATCTTGACCAAAGTTTTT
TCTTCAGTCTGGCGCTCTCCCAACTGAGCTAAGTCCGCTAACATAAGACGGAACTTCATG
GGTGGTCTGTCTTTTATATATGCAATCTTTTATTTTTATTGCGTTGCGGTTTTCAGTATT
CATAAGAAGGTGAAAAATGAAACAGATCGTTGTGATCAAATCGCTCAAATCGGATTTAAA
TTAAACTTTTTCTTCTATTTCAATGCATTTAATTAAGATAGGTAACTCTTGTGAATAAGT
GTTGGGATTGCATTGGTGATAAATCCATAATTAGGTACACAGAATATTCATGAAGTTTTT
TTTGAGGATAAAAGAATCCCCAAAAAATGAGATTGGTAAATCTTGTTGGAATAAAAATCC
ACTATCGTCTATCAACTAATAGTTATATTATCAATATATTATCATATACGGTGTTAAGAT
GATGACATAAGTTATGAGAAGCTGTCATCGATGTTAGAGGAAGCTGAAACGCAAGGATTG
ATAATGTAATAGGATCAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATA
TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAACTTCT
AGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA
Chromosomal Coordinates Chr IV from 1096064-1097386
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator