Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ZIP1
Systematic Name YDR285W
Description Transverse filament protein of the synaptonemal complex; required for normal levels of meiotic recombination and pairing between homologous chromosome during meiosis; potential Cdc28p substrate
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZIP1	6320491 upstream sequence, from -1000 to -1, size 1000
GATTTAATTCTGATTCTTTGCCTTTAACAATTGATAACGTGCCCTTTATTGAACTGCTAA
CTACTCGAAAAATTGGACACAATTCAGTTTATAGCAGGTGTCCTTTAAGTGATGTTTGCT
GATTTCCGAACTGCGCGTATGTTAGTGGACCCTAGATAACAGTTTATTCCCTAACGTTTC
TAGATAATATATGACAAAAATATACAACCGATCGACAAATTATTTCTAAAATACAAAAAA
GTTAGTCGTGAGGTTATCCAACGTTGGGTTTCTATCTATATATAAAAGCTAATCACCAAA
CAATTGAGAATCAACGCCGATAACATGATGTACAATTATAGCAGTATACGCCAGGCGTGC
TGCATTTATTCTTTACCCTGTCATCGTTGACGAATACTTTTTTTTAAAGGGATCGCACTC
TAACCACCTGAAAGGTACTATCTGAAAAAGTGTTGACTAAAAACAGAAGCGCCTTAATAA
TAGTGCACTACTGGAAAACTATATTTAATGTAAAAAAGAAACTACATTGAATGAAATCGA
AAAGTATAATTTCTCTCCGTACCTGTGACTGATACAATGTAACGATGTAGACTAAGAATA
AGATTCTCACTTAAAAGCTGCTATTTCAACTGATTATCTGCAGAGTATGCGATCACAAGA
CAGATCACAACTGTGTTTATCGGACATAATGCTATATTTTTGCTGCGCCAGAAATCGAGT
ACTAGTTTTTAAATATTTGTTCTAAACGGTCAAACTTTTCGTAAAAAATGCTATAAGCCG
TGTTGTCCCTTTATGAAGAGCTGCTTCTTCACTTGTAAATAGCGAACAAATAAAGAAAAC
AATCTGCTACCTCTTTGTTAAAGTTGACCGCCTTGAAGAGAACTGCAAGTCTCTGAAAGT
TTTAGCTGAATATTGTCACCTCTTTTAGGATTAACAGTAAGCATATTTTTTTCTTTGAGA
TTCGGAAGTAAAATACCCTCGGCGGCTAAATTTTTAGAGA
Chromosomal Coordinates Chr IV from 1032436-1035063
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator