Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YDR261C-C
Description Retrotransposon TYA Gag gene co-transcribed with TYB Pol; in YDRCTY1-3 TYB is mutant and probably non-functional
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR261C-C_YDR261C-C	YDR261C-C upstream sequence, from -1000 to -1, size 1000
GTCACGCATTCCCTTATATCCTAATGGATAAGAATTTACTTGAGAATTATGTAGCCGGGG
CGGTATTTCCTCTGGTGCTAACCGCTTGTGCAGCTTGCCATTTGAATCTTTGAAAGTAAT
TAAGTTGACGACGTTCTTACCTCTTACGAAACTAGGCTCCATTGCCCATATCAAAGAAAA
ATAAAGCAGCACACTAACAGGTAGATTGAATATCATGGTCGTTTTGTAAGTTTTTATATT
ATAAGGAGAAGTTATGAAGCAAAAGGGGATGACCGTCTAGTTGTTCTTGAAGATTAGTTA
GCCCGATGACCGGATTTATTAACAAAAAAAACTGCTTAATCATTATTAACGGTGATATAA
AATATTGACTGAACGAATGCTGAGTAGGCGAGGCAGGCACCTAGTCTCTAAACCCTTCAT
ATTGATCGCTAATAGTTGCTAAAAAAGTGCGCAAGCCCGGAATCGAACCGGGGGCCCAAC
GATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTCACAATTGTTGGATTTGTTTT
ATCATCGACATACCATACCTCAATATGACAATAAATCATGCTAAATGTTCATAAATCACA
TATGAAACAATTCTTGCACTTCAGCTTCCTCTAACTTCGATGATAGCTTCTCATAACTTA
TGTCATCATCTTAACACCGTATATGATAATATATTGATAATATAACTTGTTGGAATAAAA
ATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTTA
GAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGA
TTGATAATGTAATAGGATCAATGAATATTAACATATAAAACGATGATAATAATATTTATA
GAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTTGAGGAGAACTTCT
AGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA
Chromosomal Coordinates Chr IV from 992349-991027
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator