Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CTA1
Systematic Name YDR256C
Alias catalase A
Description Catalase A, breaks down hydrogen peroxide in the peroxisomal matrix formed by acyl-CoA oxidase (Pox1p) during fatty acid beta-oxidation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTA1	6320462 upstream sequence, from -1000 to -1, size 1000
AGAACATCCAAATTCGGAACTACTAAGAAGATATGGGTATGTTGAATGGGACGGTTCGAA
GTATGATTTTGGAGAAGTGTTACTTGAAAATATTGTCGAGGCGTTAAAAGAGACTTTTGA
GACGAATACTGAATTTTTGGACAGGTGTATTGATATCTTACGCAATAACGCCAATATTCA
AGAATTCTTAGAAGGTGAAGAAATAGTACTAGATTCATATGATTGTTATAATAATGGTGA
ATTGTTGCCTCAACTAATACTTTTGGTCCAAATCTTGACAATTCTTTGCCAAATTCCAGG
TTTATGCAAACTGGACATAAAAGCAATGGAAAGGCAAGTGGAGAGAATTGTAAAGAAGTG
TTTACAATTGATAGAAGGTGCCCGCGCCACTACAAACTGTAGTGCCACATGGAAACGTTG
TATTATGAAGCGTCTAGCCGATTACCCCATAAAAAAGTGCGTTTCTATCGAAAAACCTTC
GAAAGGAAACTCATTAACAAGGGAAGAACTAAGAGATGTTATGGCTCGGAGAGTTTTGAA
AAGCGAAATAGATTCGCTGCAAGTTTGTGAAGAAACCATCGACAAGAATTACAAGGTTAT
TCCTGATGAAAAGCTGCTAACTAATATTTTAAAGAGAAAGTTGACAGAGGAAGAAAAAAG
CTCTGTCAAACGTCCTTGCGTGAAGAAGTGAGCGGTTGTTCTAACCACTATTTAAAGCCG
CAATTAGTAATGCAAAAAGTTGGCCGGAATTAGCCGCGCAAGTTGGTGGGGTCCCTTAAT
CCGAAAAAGGACGGCTTTAACAAATATAAACTCCGAAAATCCCCACAGTGACAGAATTGG
AGAAACAACCAGTTTTGATATCGCCATACATATAAAGAGATGTAGAAAGCATTCTTCACT
GTAATGTCCAAATCGTACATTTGAATTTCTTGTAGGTTTATTTAAAAGGTAAGTTAAATA
AATATAATAGTACTTACAAATAAATTTGGAACCCTAGAAG
Chromosomal Coordinates Chr IV from 969680-968133
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator