Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HEM1
Systematic Name YDR232W
Alias CYD1, OLE3
Description 5-aminolevulinate synthase, catalyzes the first step in the heme biosynthetic pathway; an N-terminal signal sequence is required for localization to the mitochondrial matrix; expression is regulated by Hap2p-Hap3p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HEM1	6320438 upstream sequence, from -1000 to -1, size 1000
CACGGTTTCCTTTGCCAATTGTGCGATCTGGAAACTTTTTTGTCTCTTTAGCCTACATTG
CTCCCATCCGACAATCGAGCCCAGTATCAGAGAGCTCATCGCCCAATTCGTGGCCTTAGT
CGGGCTCTTATGGTATATAAATATAATAGATCCCATCAAGAACATGCTGGAAAACCCGAG
CATGCCCGCGTCTCTGAAGCACGGGATTGAAGTCAGCTTCTGCAAACTAAAATCACTCCA
TCTGATCGAGTCCCAAGCCTCTTTCAAAGTAGCCCGTTCTTGCTTCTTGGCCAACTGAGA
ATTGGACAAGTCATCGGCAAACTTGGGTGGAGTGTCTTCTAAGAGGATCTTTTGACCCCG
CGAGTAATTTGTCAGCACGCGATCACCATCTGCTTTACCCTGCGGTTGTTGCTGCTGCTT
TTGATCTTCTGTCTGATTTGACCACGGCCACCAACGCATCTTTATATTAACTGTTGAGCT
GCTCGTTACGCACTGCTGTGGACTTCACTACAATGCTTTACCGAGCAGTGGAGTTTGATA
TAGTGGTGGTACCCCCGACGGTGCTATAATAAGCTTGCCTGCACGGCTTACCCTACCGCT
CGGAAAGGCCGCCTTCGTCGCTCATTGGTCTGCGGCCGCGGGCGCTTTTTGGTCATTGTT
CATATATGAAGAAAGAGCAGGAACGGAAATTTTTCATCTTGCCTTGCCCATTGTTCTGAT
CCATGCGTTGTTAGAAATACAACGTTTGCATCATACCAAACTTCTCCATTCCGTCAGCTG
ATACTCTATTCGGTTGTGTGTTGCACCCTGCTCTGCTGTCTCTCAACCGTTCTTCCTTTA
CACGCCTTCCCTTCTCAGCTCGCGTTTCTTTTTTTTTTATCCCACTCTTTTCTTTTTTCT
TTCCTATATATTGCCCATATAAGTTTGGTTGGAAGGAAAACTAATAGAGCTAGTTGTTGT
CCCTCAATAATCATAACAGTACTTAGGTTTTTTTTTCAGT
Chromosomal Coordinates Chr IV from 927452-929098
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator