Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RAD9
Systematic Name YDR217C
Description DNA damage-dependent checkpoint protein, required for cell-cycle arrest in G1/S, intra-S, and G2/M; transmits checkpoint signal by activating Rad53p and Chk1p; hyperphosphorylated by Mec1p and Tel1p; potential Cdc28p substrate
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RAD9	6320423 upstream sequence, from -1000 to -1, size 1000
GATTTGTGATAAAGTTAATTTAATTCCCATTATTCCAAAAGCCGATGGTCTCACAGAAAC
TGAATTAAATTTACACAAAGACATTGTGCGCCAAGAAATCTCTCAGAACAATATACGTGT
TTTTGATTTTAAAAGTGACACCCTAGGCGAAACATTAGCTCTGTACGATATGGACATCGA
TTCCAGTTCAGCAAAATCCAAATACGATAATGACACGAAGATCAAGGAAATATCGCCATT
TGCCATTGTTTGCAGCAAAACTTTTAATAAAAATTCGGAAAATAGGGTTGAGCATATCAG
AACGTACGAATGGGGTAGCTTGGTGGTCGAAGACCAAAACACCTCCGATTTTATATACTT
AAAAGCAATACTGTTAGGTTCTCACCTTCAGGAATTAAAAGATGTAACAAACAACGTATT
GTATGAAAATTATAGGGCTAAAGTGTTAACTGAGAAGAAAAACAACTATGATATTCCAAA
CTATAGCTATATCGACGAAACCTCAAGGGGAAGTGTCAGCAATGTTTCCACCAGAAGAAA
TAGTGCAAGTAGAACACTTGGGAATCCAGATACAAACGATGAAAATGCTTATCAAATACA
CAAAGAAATAGACGAAAAAAACAGAATTATTGAAGACTATCAAAGGAAGATTGATTTATT
GGAGAAAATGTTGGCAGCTCCCCATCAAAATAAGGTCTAAATAAATATACGGCCTTGTTA
GCGTTAGATACATATGAAATAAAATTTTATTGCTTTTTCAAGTGCACTAAAGTATAAGGC
AAAATTTTTTTAATCTATAATATACTTTCTCGATGTGTCTCTATATAACCTTGTGTCTTT
CTTATTACTGGCACGGCTTTGAATTTTCAGAGTGCAGTTCTGATTAAACACGCGAGGATT
TTTGTTCGTGGATATTTGCAACGATGAGCAATGTGAAGTGAGCAAGATAGAGAAACGCCA
TAGAAAAGAGCATAGTGAGAAAATCTTCAACATCAGGGCT
Chromosomal Coordinates Chr IV from 903480-899551
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator