Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name UME6
Systematic Name YDR207C
Alias CAR80, NIM2, RIM16
Description Key transcriptional regulator of early meiotic genes, binds URS1 upstream regulatory sequence, couples metabolic responses to nutritional cues with initiation and progression of meiosis, forms complex with Ime1p, and also with Sin3p-Rpd3p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UME6	6320413 upstream sequence, from -1000 to -1, size 1000
ATTGTTGGGTTTAACTCTTCAATAGAGGTCGGAGTGGAAGACTCACCATCTGACAAGCGA
GGACTTTCCATGTTTGACTCCGAATTCGATGAAGAATGGTAGCTAGTGTGATTATTGCGA
TCCTTTTTTATTCGATGGTTCGAATCCGGATTCGAATTCGAATTCGGCACCGAACGGTCT
TGATGTCGCTCAATTATTGCAGAGTGCAATAGCGATGGTTCCTGTTCTGTTTTGCGACTG
GTGGATGTTGTCAGATGTAGCGGTACAACTGAAGGAGGTTGTGATCGCAAGACTGACATG
AGTTAGAAACTATTGATAGGGAAAAGCGATATAGGGCAACTGTCTCGGGGGGTGTAAACA
GGTTTCGTACTCTCTTGCTTATGAATGTGCTACTTCTTGTTCCTATTTTTTGTTTCTGTC
CTTGTTTTTTCTTTGCTTGTCCCTCCGTATTTGCTTCTTTGTTGTCACGCTTTTGTTATT
TCCACCTCTATCTTTCCTCTCTGTCCCATTCCCCATCCATTCCTTTCTTTTTTTTTTTAA
CCTGTGTTTTGTTTTCCCAGAATGGGCGGCACGTTCTTATGTCCGTAAAAACGGATATAC
AAAAGCGACACGTCGTCTGAGGTGACACTCCACTCAACCCCACTTGCCCAAAACATGCAT
TGCTACAAGTAGTAGAGCGCAGTTTTTAAAGTCCATTGGTTGCACACGAAATCACGAGAA
TAATCACGAGAATAGAATGCACGTTGGATTTCGGGCATCCTATAATTGCCAAGACTGCGC
TACTTCTCTTCTGTTTCGGTCCGGGTGACACGTCCGCCGTGCTTCAAGGCGCCTTTTCAC
CAATGCCAGGCGGAAACTGCCGCCGTCAAAAAGAAAAATGAAAAGAACATAGAGGACAAG
GACAAGAGACCAGTGATCGTAAGAAGCGCCCACCTTCGCACAGCGCACAGGAACTAGGAC
ACTACCGCACTCAAACCATTTGCATGGACCTTAACTCACG
Chromosomal Coordinates Chr IV from 867522-865012
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator