Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HSP42
Systematic Name YDR171W
Description Small heat shock protein (sHSP) with chaperone activity; forms barrel-shaped oligomers that suppress unfolded protein aggregation; involved in cytoskeleton reorganization after heat shock
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP42	6320376 upstream sequence, from -1000 to -1, size 1000
CACTAGCTTCACCTAAAAGCAAAAAATCTCAAAATTCCCAATATTCACATAGTCTAAAGT
ACCGATAGCAACCAACATATATAAACAGTAGTATTTTACGAAGCTGAATTGCAAGATTAG
TGAGAGGAGAATAACCGGATAATTTTTTTGGATTACGTTATTGTTAAAGGCTATAATATT
AGGTGAAACAGAATGTCCTAGAAGTTTTTTTCTTTCATGTTAAATTTATTGATTCTTGCG
CTTCAGCTTTTATAAAACATAAGAACTGTTTCTTCACGTTAACTTCTTGTGCCACATATA
ATGATGTACTAGTAATATGGGTACTATTTGGCAGATGATATTTGATTTTTATTCAAGACG
GTTACTGTTTCTACGATTGATATTTTCATTCCTGGATATCATCTTGCCAGATCACTTACA
ATTTAGGCCGCGCCTGAATTGAAGAGTACTTCAATACGTAGTGTACTGTCCAAACTCTCT
TCCAAATTTTTAATATTTAGCTGGGGTTGGGTAACAAGTGAGCAAGGGAAAAAGTGAACA
TTTTAAGAAGAACAATAAAATAGCAAGAGATGGAATGGTAATGCTTGGCTCTCGAGAAGA
GTAGCATAAAACGAGACTTGTTTAAAACAGGATATGACATACTTCAATTCAGCTTTCCCT
ATCAGCCGCTCGAGCAGTTATATAGGTGTGTTGCCGGAGTAATTTGGCGGAGGCCAACAG
TGGCTAGGCGGCAACGCCTGGAACACGCGCTTAAAAGTTCTGGAAGGTTCGCGAATTGAG
AACTGCTCAGGGGCGAATACAGGGGCGGCCTTGGCGGCAGGGGGGAGGCCTCTGTGAAGT
TAGTTATATAAGACTTGCTGTCATCGTTTTTTTGATCCCGGCAGGAACTATCTTTTATTC
TCATACATACGGTCAAGAAGTATAATTATACATAACATAGGGACACGTTCAGGCAATTGT
CCATATCCCACACAAATTAAGATCATACCAAGCCGAAGCA
Chromosomal Coordinates Chr IV from 806621-807748
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator