Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SWI5
Systematic Name YDR146C
Description Transcription factor that activates transcription of genes expressed at the M/G1 phase boundary and in G1 phase; localization to the nucleus occurs during G1 and appears to be regulated by phosphorylation by Cdc28p kinase
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWI5	6320350 upstream sequence, from -1000 to -1, size 1000
TGTCACAATTTGCAGACTGGCGCTTTTTCTTAGACATTTCTGGTGAGGCTGTGCCGACCA
AGTAAGTTCGGGGCATTGCGTCACTGCTTGTAAGTGAATAATTGGTGTACATTATGCCAA
ATTGCAGATCTGTATCTGTTAATTTCTGCTACTACTTTCGTACAAACTATAGCTGCGTAC
CACAACAATTTAGTAATTTTGTGCCAATCTGTTATCTCAACAACGACATCTATTGTTTTG
TAGATTTGCATACACTTTCTTTTGCAAACGACCTCCGGGTAGCCAAAACCCAAACGATAT
TTTTTTACTATCATCACCGTTTTCACATGCTGTCTAGTGGCCTAACTTATGAAACATAGT
CAAACTACTTATAAAACTTCGGCAGTCAGACAGTTCTTTCATTAAATGGTGTCAAGTAGA
TATTTACGGCATTGGATTCTAGGGCCAATGTTATTTCTGTCTTAAAGGAGAGCGAATCAA
ATATCGGAGTGTTATTGTTAGATATTCTGAAAGGTAGTATGATTATCTGAAAGCCGATAG
GAGTGGTACACTCCGCTCACACCTTGTTAAATATTCATTAGAACATCTCTGTTCCAATTC
ATAGCAGCATTGTTGGAAATATCTTGGTCTGAATCCCAATCCGGGCAAGTAGAGAGGATG
AAATTTTCACTTTCGTACTTTAACCTGTTTAGGAAAAAGGTAAACAATAACAATACCTAC
CATTAGCGACTAATTATCTTTCTTTCTCCCTATAGATCTGCTCTATAAACAATGATTGAG
TACTATAGAGGATCGTCTGCAATTTTATTCACTATTTATGTATTGGCACGGAAGACAAAA
AGGCATCGTTGGAAGAAAGATTTGAGAACGACAATATAGATACCACCATATAACTCGTTC
TTGGAGCTAGGTAAATAGATCCTGAGAACGTGTTTAACATCTGCGATATAATTAAAGCGC
AATCAAATAAAATATTAACGTCATTGTTTTTTCGAAAAAG
Chromosomal Coordinates Chr IV from 750742-748613
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator