Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name INO2
Systematic Name YDR123C
Alias DIE1, SCS1
Description Component of the heteromeric Ino2p/Ino4p basic helix-loop-helix transcription activator that binds inositol/choline-responsive elements (ICREs), required for derepression of phospholipid biosynthetic genes in response to inositol depletion
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>INO2	6320328 upstream sequence, from -1000 to -1, size 1000
CAATTGAAGATGATATAAAACTCTCTGAGAACAAGTTTTTTGGAATTGACTCACTTATTA
AATGGTCTTTTTCCTTTATGAACACCATAAACTCATATCCTTGACCATTTAGCAGCGCCA
GCGCCCTTCTAAGCTCTTCCATACCTATACGCATGTACTTAAGCTGACTCTATCGAAAAA
TGACGTACGCACAAATGCACATGTATACATACGCAATCCATCCTTTATATAAGCTGAGAA
ACAAGCAGAGGAACCTGCTTCAGTTGGGCCATCCCTTCGATGCTATATACTTCTAATCTT
AAACTCTTCACTAAGACTTCGCAGGCACCGCTTCAAGGATGTCTCAGGTCGCGAGATTAC
TACAACAACTTAAAACAACCCTGATGCAACTGCAGCGTGCTGTTTTTCAACAGTACAAGA
AAAAGTTCCATATTGTGCCATTGCCGATGCCATTGCAAAGGAATTTGTTCTCAGTCGCAT
CTCTCCTTTACTGCAGATCTGAGTTACTTTGAATCCTTGATAATATGGATCGAGTGCCTC
TTCCATTATTTCTATTATTATAATCTCAACGCTTAATATGAATTAACCAACCACACTCAA
ACCAAATCTACGCCAGCTACAAATGGTAGGAGAATGAAGACACACCAGGACTCAAACAGG
ATTTCCCAACAATGTCTTTCAACATGCTGCTTGCCGGTCACTACTGCACTTCCTGCGCCT
TTTCCGTTGAATCACCCTCCATAGTGCGGCAGATGGAACCAACCTAACCTTTTTTCAGCA
GGAGGTAAAAAATTCGCCGGTTTTCTATCTCCCTCCGTCATCGGCAGGGCGTTGACACCT
GTCCAAGTACAACACACATGTGAATTTTTTTCAGTGATTAAAGGCTCATCTCATCATATC
TTATTGTAATCAGTATTTGGCGTCATAAGCAATTCGAAATTGGTTCGGTTCCATCTCGTT
GACGTGCAATAAATAAATACATGGAACAGCAAAGGAGAAA
Chromosomal Coordinates Chr IV from 699468-698554
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator