Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RLI1
Systematic Name YDR091C
Description Essential iron-sulfur protein required for ribosome biogenesis and translation initiation and termination; facilitates binding of a multifactor complex (MFC) of initiation factors to the small ribosomal subunit; predicted ABC family ATPase
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR091C	6320296 upstream sequence, from -1000 to -1, size 1000
CCCGCGGCTCCCGCAGAATCTAATCATTAAGCTTGACTAGTATCAAGCTTTTTTCCTTCT
TGTTCTGCATTCAAGTATTTGTTGGTAGTATTTCTAGACATCGAAAAGCTTTTTTAGCCC
AGAAAAAAAGAGATGAAACGCTTAAATATCTCAAAATTAACATGAATTTATATTCTGTAA
AAAAAGTATCGTCGCAAAATGAGAAATTAATGTTTAGCGATCTAATAGTGATCTTGAATA
TTTGACTACTTTGTTTGGATAACTTTTTCAGCATTGTCAGCATGCCCAAGAATAACGATT
ATTTTGCATCCAGATAAATGCTTCCAAGAACCTTTACTAGTTTTGTTTCTTGGTTTTTTA
TCGTCTAAATAAAAAAAGACGTCCTTGTTAAATTTCTCCCCAGTTGAAAAAAAATGTCTT
GTGGCCTATCATGGTTTACTACAAACTGAATTGGAAAAGGATTTTCCTAATAGTTTGATG
TCATGTAAAACGCCCTCGTATCTGCAACGGAAATACACAAATAAAGAAATATCAAATTAG
CCGCCGACGTGTCATTTTCGTCGTTGTTGATGATCAAATTATCACAGTAAAAAATAGTAC
GGAATAGCGTACTTGAAAGGAGCATCGTTTAAAACACCGCGGAGGATAAGAAAGAGCCGG
TCATTAGCATCCTACCCTTCACATAGTAAAGACTGAACATGACTATACGCTGCTTCAGTC
ACCTGTTCATAAGCAAATACCATGGATAGAAAAACAATCTCTTGTTACTCGTGTGCATCG
AACCAGATTTCTAGCCGGGTAGTTTTGCAACTGAAAAAATTTTCTATTTTTTTTCTCAAT
CGCATCGCTCGCTAGCAAAGTGAAAGTGAAAAAAAAAAAATGTAAAACTGGGCATTAACC
TTTATTGTTTCTGTATTCTTAGATCTTCATTGTGATCTGTTTCAGCGCGAATTCCACCTA
GCCTTCTGCAAAAGTTCTTAAGAAAACACGACAGACCATA
Chromosomal Coordinates Chr IV from 628534-626708
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator