Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name LCB2
Systematic Name YDR062W
Alias SCS1, TSC1
Description Component of serine palmitoyltransferase, responsible along with Lcb1p for the first committed step in sphingolipid synthesis, which is the condensation of serine with palmitoyl-CoA to form 3-ketosphinganine
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LCB2	6320267 upstream sequence, from -1000 to -1, size 1000
GAATATGTATCTGAAATATTTTGGCCTGGACAAAGACGCCGATAGTGTTTTATTTGAACA
GTTGTCCGTAAGTGACCAGAAACTAGTCCTTTTTGTCAGGTCTTTAATTAAGATGCCGCA
AATATTGATTCTCGATGAGGCATTTTCTGGAATGGAGGTAGAACCTATGATGCGTTGTCA
TGAATTTTTAGAGGAGTGGCCTGGAACAGTCCTTGTAGTGGCACACGTTGCCGAAGAGAC
ACCAAAATGTGCCCATTACTTAAGGCTCATATCTCCTGGAGAGTATGAAATAGGCGATAT
GGAAAATTAAAGTTTTCTGTTGTGTGGCAGCAAGAGACAGAACCTCGATAATTTGACATA
CGTATATAATAGTACATGTACATAAAAAGCTACGCAAATATCGTATATCTGTTATACTAC
AAAACAATTACTTCTATATCATAGCCAGTTAGCGGGAACGACTTCAGCTAAATGGACTAT
CCATGCTTTAGGCAGAGGCGAAGCGCGGTGATTGGGTGTAACATCATCTCCTTTTCTCTA
CGACAAATTCCCAAAAAAAAAATTTATGCTATGTTAATACCTGCACAATTCAACCGTGCT
GAAACGTAAAATTAAGGTGATTATACGGATAGTATACGATATTATCAATCTCATAAGAAA
AATCTCTTTTGAATTTAACGGAGGGATTATTCATTAGAAAGCGTTCTTACCATTCACTAG
GAGCGAATCCGTGGAAGGTGTTTTAACGTTGCCACGAAAAACAGCTCTACATCGAAATAA
AAGACAACAATCAGTGCCCGTAAGTTTCATTACTATTTTCTATTATTATCTGCAACTTTT
TATTAGTTAGGTTTTTTTTGTTTGTTTGTTTGTTTTCAATTGATTAATTTACAAGACAAA
GAACCTTATATTTCGTGTTTTTCATTCTAAAGGAAAAAAAGCATAAAGAAGATTCCACAC
ACTTTATTGTGATAGTTTTCAAAGTAAAAAGTAATAGATT
Chromosomal Coordinates Chr IV from 576474-578159
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator