Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SES1
Systematic Name YDR023W
Description Cytosolic seryl-tRNA synthetase, class II aminoacyl-tRNA synthetase that aminoacylates tRNA(Ser), displays tRNA-dependent amino acid recognition which enhances discrimination of the serine substrate, interacts with peroxin Pex21p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SES1	6320226 upstream sequence, from -1000 to -1, size 1000
TTAGTGGGAAACATTGCATAATCACTTCCGTCCGTGCTCTTTGATTCATTATTGTATGCT
GGTTGATCATCGTTGCTGGGACCCTTGTTATTTTTGATATTCTCTTCTAATCTGTACTTG
ACATTTTTATCATAAACAGTAACTGTAACATTCATTCCTGTTCGCAGATTTCAGCAATGT
TTACCGGCTTAATAAGAAAATGGGAATGCGACGTTTATCTTGGATATTGACCACCCTTAT
ATTATGGATATGTACTTCAAATTATTATCTTTTACGATAAAAAAGATTCTGATCCAACCG
AGGTTCGAACTCGGGATCTTCGCCGTGTAAAGGCGACGTCTTGAACCACTGGACCATTGG
ACCGGAAACCCATTGGAAATGACTTAATCCCAATATCGCTATATTAAATGTAAAATAACT
TTTTCAGGATAATCCACAAGAGTGGTGCTTCTGTCATTAAACTAATTTTTTTAAGGCCTG
TTCGCCTATTATATGTCGAAAGTGTGTATTTCTTTCAAGTTATGCCTGCAATTCAAAGGA
CAGATTTATTTTACAGTGTCGACGACACCGTTTGAAAATGCAGATGCAGGACTGGGCACG
TTTTACAATACGTATCGAGTCAAAAATACACTGATTTTGGTGATATTAGCTGCAGCATGG
CGAATTTTTCACATATTACTGATAAGGATGGACATTATGTTTGACTTTTTTCCTTAGAGT
AAGTATGGTCAGCAGAACAAAAAAGAGTTCCTACATTTATACGAAGGTAAAATTGTAAAA
AACATGAATGCGGCCTATCCGGCTCGAAAATTGTTCCTCATATATATTAAAAAAAAATCA
CGTGGTGCAAAAAAAAATTTTTTTGTCATTTCTTCGAATCAACTCAATGAAATTTGAAAA
ATAGCAGAAAATAAGTTGATAAGATCGCAATGTAATATATATATATATATATATATATTA
CAATTCGTGAACTGGCACAAGGAAAAGCGTGTAATTAAAA
Chromosomal Coordinates Chr IV from 489508-490896
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator