Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GDH2
Systematic Name YDL215C
Alias GDH-B, GDHB
Description NAD(+)-dependent glutamate dehydrogenase, degrades glutamate to ammonia and alpha-ketoglutarate; expression sensitive to nitrogen catabolite repression and intracellular ammonia levels
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GDH2	6319986 upstream sequence, from -1000 to -1, size 1000
GAGCACTTGACGTTTGGTCCGTGGGGATAATATTCTTTTGTATGATAACGAGAAGATTTC
CTTGGAAATATCCCAAAGTGAAAGATGTTCAATTCAAGGCATTTTGTTCCGGAAGAGGTG
TGTCATCTTTTAAAGATCTTGTGACACGGCCTGCTACCGATGACAGCAATAATTATGATA
ATGATGGCTACGAAGAAGGAGTCATTGATATGGGTCCCAATTTCATTCTGCACAGACTAC
CAGAAGAAACTCACAAAATAATGAGGCGTATACTGGAAGTTTCACCTTTCAGAAGAATTA
CCATAAACGGAATATTACAAGATGGCTGGATCAAAGAAATAGAAACGTGTCAAGTTGTGG
GCGCGGCAAGCCCAAATGAGGCATCGCTTCGAATAATAAACAAAGGTAATCACATACATA
CAAACATCGATCAACGATACGCCCACATTGGCGGCCTGCATCAGCGAACGTAACTGGAAG
AATAGCAATGTCATACTGGCCATATGCTCCAGCTTTTACTTACGCAAGTAATACTTACAG
CACTGTAACCATAGGTACATATACGTGAAAATACGACTATATCTAATCTAATCTGTCATT
TATTTATTTATTTACCGTCGGAAAACCAAGTCCGCTTGAAAAGGGTTACCCATCTGGCGG
CTATGTGTGCGGCGATTCCGCAGGACCGAATTTAATACTGCCTGACGGCGTGCCACAACA
AGGAGCAATTGGGGTAAAAATACACATTAATAGTTGAGTAGGACAAGTAACTACGAGTCA
ACGGCGGCATCAATAACAATAACAAAAGTTATACTGTCGACATCAACACTGACAAGCGTT
TACTCATTGCTGCTGTTTAGTCAGAATTCTTGTTATATAAGAACAACCGGTTTCTAAAAA
ATACATTACCTTTTGGTATAATCCTTTTTGTGATTGTCACGATCTCAACAAAACATACAA
AACAAGGATATTAAATTCACAACAATAAAAAGAATAAAGA
Chromosomal Coordinates Chr IV from 73918-70640
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator