Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name LYS20
Systematic Name YDL182W
Description Homocitrate synthase isozyme, catalyzes the condensation of acetyl-CoA and alpha-ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys21p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDL182W_LYS20	YDL182W upstream sequence, from -1000 to -1, size 1000
ACCAAATTTGGTATACTGCGTGCGCTTGAGATTCAGTTTTTGTGTAAATCGGTTGCTGCA
AACTATTTATATTAATGTTACATCGATGCAAGATTTTAGCCATGTTCCTAGTTTCTTGTC
TATGAGCGTTTACTCAACCGAGACTCTTGTTTGCTATTATCTCGATTCGACGAACAAACA
GTTCCCTGGGTATTCGAACAAAGCACAGTTGGTGATTTTGTTTGAAACTACAGACGTGCT
CTCTTTTACAAAATAAATTGTAGGAAGTGATCCGCACAGGCAGAGGGAATTACAGATCAC
GCTCCTCTCTTATGACTAATGCACTCAGCATTTTCTCTTCCTTATAAACTCCGTCCACAG
TACCCGATCAGCTGGCTCATCGTTATTCTAAATTAACTGATGACTGATGTTACGTCTGCG
TCAAATTCCGCCGGAATATTGCGTAGTTTTAGTAAGAAAAAAACAAATTCCGACGGGAAC
TCTCTGCAAGGAAGTTTAAGCGTGGGTTACTTTGCTAGGTTGAGAAAAAGAATTCTTTAG
AGGATCACACGTAGTAAAAGAAAAAAAAGATCTCTTCGCGCCACTCCCGGTTTCTCTGTG
GATACGGCGTTACTAGCGTTGCAAGTGGCAAAAAAATGAGTAATGTCACAATGGCCTGGC
CTTGTCCCACTATCCCTTATTCATGGTTGAAAAATATGACCAAAATTGCTGGGGAATTTT
CTCTTCGGTAGTGGACGACGACGACATTAGAGCAATAGGCAATAATTTAATTTGCGCTTT
AGGTTCTTGCTGACGATGATGCGTGAGTAATATTATTACCAAGTTTTAAGGGCCTCATCG
CTGGCCATTTTTTACACCTGCTTAAATACCCGATGATGATATATATAAATGATATTGGCT
GCTTATCGATAAAGTGTATTTGATATGTTCCCGTTTAGTTTATTCTTGTTTCTTATCTAC
ATAACAAACAAAGGAAGGACCCTGTATTGTTTTCCTAAAG
Chromosomal Coordinates Chr IV from 133437-134723
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator