Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name UGA3
Systematic Name YDL170W
Description Transcriptional activator necessary for gamma-aminobutyrate (GABA)-dependent induction of GABA genes (such as UGA1, UGA2, UGA4); zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type; localized to the nucleus
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGA3	6320031 upstream sequence, from -1000 to -1, size 1000
TTCATAAATTCGTGAGGAATACCTAGCAGAATACCGGCACCGTCACCGTTCCCATCAGAT
GAGACGGCACCACGATGTGTCATATTCACTAAAAGATATCTAGCGTCAGTAACAATCTTG
TGAGACTGTTCACCATGCTTATTTGCTACGAAACCGACACCACAAGCGTCATGTTCATAA
TCAGGGTCGTAAAGTCCTCGTTTGTCCGGAATCACATTTGCCCAAGATTTATGAAGATGG
TGTTCATCGTTATAGTTTTGAATTGTCCCACCTTCGTAAGCTTCTTCCAATGGATCGAAA
TTGTCTGATTTCAACACTGGCATGCTTTCTTTTCTAATTCTTTTTCTAGTTCTTCAAAAT
AAATAAATGGCAAATAGATTAAGAAAAAAGAGAGAGTAGAAAGACAAAAATAAATAAAAA
AAAACTGAAGCAGAAAAATAAATAAATAAGTTAAACGTTAATCACTACCTCAATGAGCTA
AAAGAAGGGGAAGAAAGAGCAACTGAGAGTATCCGTCTGCGTAGTATAGGACTGAGATAG
CAATTTCCTATCTTCCTATGATGTGGAGACGATTAGTTTGGTGTGTTATCAAGTAAGATA
TAAGAATTGATTAATTTGGTAAGAAATGAAACAATAGGACGAAAAATACAATAAGATAAG
GAAGACCATCAGAACTTATGAATGACTAAGAAAAGCAGTTTATATTTTTTTTTTGGGCAA
TTTATTGCTTCTTTTTTTTACGTTTTGCGGGCATCACGTTCGTCGTGACATATGACTTGA
AAAATGTGCAAAAGCTTATCGGAGCCAATCGGATTGACGCATTAAAACCGAAGTGTATTA
GGACCAAATTTGCGCTGTATAGGGTTGAACGGTAGGGCTACCAGGGTCTGAGTCATCAAA
GAAAAAGAAATTACAATAAGAGTCTTACTTAAGATGATATAGAATTGTTGTTATTGTTCA
TGTATGGATGCCAAGAAAACAAAGTTTTTTAAAGTGAGGT
Chromosomal Coordinates Chr IV from 156318-157904
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator