Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CDC9
Systematic Name YDL164C
Alias MMS8
Description DNA ligase found in the nucleus and mitochondria, an essential enzyme that joins Okazaki fragments during DNA replication; also acts in nucleotide excision repair, base excision repair, and recombination
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC9	6320038 upstream sequence, from -1000 to -1, size 1000
CCGTCAACCTGCTAGCACTAATGGCTCTTTGCAAATCATCGTCATTTTCATCACTGCGCC
CAGTTCCCCTTCTTCTTCTTCCTTTCCTGTTTCTTCCCTTGATATTCATGTTCCTTTCCT
CGTTCAGTCTTTCGTCATCAGATAGTAATGCAGTCAATTCTTTTGCTTTGACCCTAACGA
TTTGACCTTGATCTATGCCCTCATCGTCCTCGTGCCTGAACTCCTTCAATGTCTTGATGA
TGTATAAATTTTCTCTACACCAAAGAACACAATTCTCACTACCAAACCTGATCAAGTAAT
CTATTACTGTCAATGCCTTTGCGATATGCCTCCAGTATTTGCCCTTGTCGTTAAGTCTTT
TGTCCAGCATATCCATGATTTCGAAGAAATCTGCGCTATCATATGATTTTTCAGCCAGCT
CAATTAACGAGTCCTTGGACACTTGATGATTGTCGTTTGACGTTGCATTTCTTACCAGGA
CCTGGGTAGAAGAGTACCCTTTCACCAAATTCTTCGCAGATCTAACAAATTGTTTCGACA
TGATTGTTCTGCCTCTTGCTCCCTTTCCTTCTGATCCTGGCACTCATACGAACGGCTCTT
TCTTCTACTTCTTAAAACTCCTATTTGTCATTGAAAGAAACTTTCATCATTACCCGGATG
ATTCTCTATACGTAGCCACAATTTCAGACAACCATACTTCCAAAATCAAGTACTTTGAAC
AACATAAGGCCCCACCAACCTTCCGTAAGACTTGCAATAGGAATTCGTACTGCAGCCGCT
GGTTCTATTGCTGTTTAACTCTGTCATCTTTTTGCTCGCTTCGATGTGTTCCTCCACTTG
AGATGGCTGATGGAATTTTTCACCTTAACGCGAAAACGCGTGAAAGTGAAATTTAGCTGC
AATAAGCCATGCGTTTGCATCTCGCTGTACTTTGTTCAAAAATAAAAGTAATGATTTTGG
AGGTTTAGAGCAGCTTTTAACGTCATTGTTCATCAATTAC
Chromosomal Coordinates Chr IV from 167254-164987
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator