Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ARF2
Systematic Name YDL137W
Description ADP-ribosylation factor, GTPase of the Ras superfamily involved in regulation of coated formation vesicles in intracellular trafficking within the Golgi; functionally interchangeable with Arf1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARF2	6320064 upstream sequence, from -1000 to -1, size 1000
TACTACAAGCAACGACACATCGTTCTCTCCATCACACAATAGCAATGCAAGAACGTCCTC
TAATTGGACGAGTGACCTCGCTAGTAAGCACAGCCAATACACTTCCCCCCAATAAAAACC
AATAGCATCTTACGATCGTTCGAGGTCTTATAAACCGTTTTATATAAATTATTCTTATAC
ACGCACTCTTGAGTTTCTTTTAACATTCCAACATGATAGACATAGAAAAGAATTATAGAT
AACACATAACATTACTCACAAGTAGCCCATGAGTTTGATTTTTCCTCGTTAATTCGGTGT
CAAGTGGAATACAAAATGGGTCAACTGATCATAACTATTACCCGGATAATCTACATCATG
TGGTACGTTAACGATGTATGGTTTCCTAAATCACCGGGTTCCAGATGCGGGTTGTTGTTG
TTCGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACCTTACAGGAGATC
GGACGTGTGCGATTATTGTTACCTCGTCACCTGTTATCGGTTGAACTGTTTTAGCTCTTT
CCATTCCCTTTGTTAATAGTAGTTTAATTCTTCGGAAACTTTCTACGCAGACTCAAGTTG
CAATAGGCTAAAGATAAGGCAGACACTTTGTATGTAACGAGTTTCATTAGGAGGGATAGA
CGCACGACACTATCTGGTACTACGTGTTATATCATACCCAGAAGGAAGGACTCTCTCCAC
TGAACGGTGGGATGAGTTCCTAAAGGCGCCCCTTTATTTGATCAGGAAGCCGTATTGATT
ATCTAATAGGGCCTAGTTATCCTAATTGTGGGGAGTCGAGCAGTACGGCTCTGATGTTTT
TCGAACGAAGATAAGGAGTTGACATACAAAGTCAACAGAAGTTCTTCTTGTTAGCGTCTC
TGTGCTCAATATCTCTCTTTTTTTCTTTAAGTAGTAATTACTAACATCAGCCAACCAATA
GAGATAAAAAAAAAAGGAATTAAGATTTCATAGAGAAAAG
Chromosomal Coordinates Chr IV from 216529-217074
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator