Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RRP42
Systematic Name YDL111C
Description Exosome non-catalytic core component; involved in 3'-5' RNA processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase PH and to human hRrp42p (EXOSC7)
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRP42	6320092 upstream sequence, from -1000 to -1, size 1000
GCCGAATATCCCTTCTCCATATAAATAAGACACTTTTCACCAGGAAAACAATACTTCAGA
AGCTTATTTCTCTTGACAAAAAGAGGGGTAAGATCTTTATAAAACATAAAGCAAATCAAA
ACATAATAACTACTACAAGTAACATAATGTGCTCAGCAGGCGGTATCAGAAGACCAATCC
AGATCGAAGAATTTAAGACGGCGATAAGCGGCATGTCCGACATGGAGTTGGCACAGATTA
AAACAGAAATTGAGAACAGTATCAATCATTTGCAGAGGTCTAACGCCCGCTTGGGTAAAT
ACATAGCTAAGTTGGAGGGTGCTGACGACCGTCTTGAAGCTGACGACAGCGACGACTTGG
AGAACATTGATTCGGGAGACCTGGCGCTGTACAAGGACTCTGTCAGGGAGAACGAAATTG
TGCTAAACAATTACAATGAGAGAGTGGACGCATTGGAGCAAGAAACGGTATATAGAAAGA
CGGGCCATGGCAAGAGTAAGCACGAGGTAGAGGCAAAGGACAACACCAACAAGGGCCCTG
ACGTTGACATGGACAATTCAAATGTGGACGTCGTGACACCAAACAGCATATTCATTTAAG
AGACGGGATTTAGTTTTACTGCGCATCATTTTCACGTCATACTCTTTGTCTCTCTGTTCT
ATCTCTTCGTATAAATATTTCAATAACTCCATTTGTCTATTCTATCTACCCGTTCTATCC
TTACTACTAGATATCTTAAAGAAATAATAAAATAAGTAAATACAAAAAAAACTCGCTATT
AATAATTTATCTCCGAAAGCCCTAGGGTGTGCTTTTCTTCCGTGCCCTAGTCTATTATTT
TGAACCCTAGTTGGCGAAATTTTTTTCTAATATTCAGAAAAAAGAAACGTAGAGCTTATA
TGGTGAAGGAGTACAATGATACTAATAGTCTGTAGACGGCAAAAGGCATTCTTTTTGACT
AGCACAACGACAGTTTGAGATTCTGTTGAAATAATCATTT
Chromosomal Coordinates Chr IV from 264110-263313
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator