Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ASM4
Systematic Name YDL088C
Alias NUP59
Description Nuclear pore complex subunit, part of a subcomplex also containing Nup53p, Nup170p, and Pse1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ASM4	6320115 upstream sequence, from -1000 to -1, size 1000
CAGAATGTCAACTATGTCAACGCCTGCCGCAGAACAACGCAAACTCGTCGAACAGCTGAT
GGGCAGGGACTTCAGTTTCCGCCACAACAGGTATTCGCATCAAAAAAGAGACCTCGGACT
ACACGATCCCAAGATCTGCAAGTCATACCTTGTTGGCGAGTGCCCCTACGACCTGTTTCA
GGGCACCAAGCAGAGCCTGGGAAAATGCCCGCAGATGCATCTTACCAAGCATAAAATTCA
GTACGAGAGAGAGGTCAAGCAGGGCAAAACGTTTCCCGAATTCGAAAGAGAATATCTGGC
CATTCTATCTCGGTTTGTTAATGAGTGTAATGGCCAGATATCCGTAGCACTACAAAATCT
AAAACACACCGCTGAGGAACGAATGAAGATTCAGCAGGTTACCGAAGAACTAGATGTCTT
GGACGTGCGGATAGGCCTAATGGGACAAGAGATTGATTCTTTAATTCGTGCAGATGAAGT
CAGTATGGGTATGCTACAGTCAGTCAAATTACAAGAACTGATTAGTAAAAGGAAAGAAGT
TGCAAAACGTGTACGAAACATTACAGAAAACGTGGGCCAGAGCGCCCAGCAAAAGTTACA
GGTTTGCGAGGTGTGTGGGGCATACCTATCGCGTTTAGATACAGACAGAAGGCTTGCTGA
CCACTTCTTGGGGAAGATTCATCTGGGATATGTCAAGATGAGAGAGGATTATGATCGGCT
AATGAAGAATAACCGGACAACTAACGCCAGCAAGACAGCTACTACACTACCCGGAAGACG
CTTTGTGTAGGGCCATACATAAAAAAATGATGCTAGAAAAATTTTGTTCGAAGGAGAGTA
CTTATGAAAGAAGAAAGGTTTGTGAATATCACACACATACCTCTGCATAGTTTATTTCCC
GATAAGGTAGACATATCGTTTCCCTATCTATTTAAGTTTTTTATTCGCTCTCTTTTTTTT
TTTTTCTCTGTAACCTGAAAACAAGGAACGGCAAATTAAA
Chromosomal Coordinates Chr IV from 300003-298417
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator