Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL31a
Systematic Name YDL075W
Alias RPL34
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl31Bp and has similarity to rat L31 ribosomal protein; associates with the karyopherin Sxm1p; loss of both Rpl31p and Rpl39p confers lethality
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL31A	6320128 upstream sequence, from -1000 to -1, size 1000
GTCTGAGTAACTTGTGGAGTCTTCATCAAAAGACCCTTCTTTGAAACGATTGTAATAAAG
TGTACCCAAGTTTTTTAACTTGTTTGGATAGTGTTTCTCAGTGAAAGCAAGAACCGACTG
TGAACTTACATTAGGCAGGTCGTAGGCCGAATTTCTGCCGTTTTGGTAATGCATATACTG
CTCTGGAAAAGAATGGGTGTTGCTTTCTTGTCCCTCCTCTTGCTTATTTTTTGTTCTCGC
CGAATTTAGTAGTGTTTCCTGTAGTTTATATATCTGGGATTGAGTCTCTCTGTACGCCCT
ATTAGGATCTTGTTCGCTTACCGACATTTTTATCTTATATTGTATTGTTACTTCTCTCAA
AAAAAAAACTGCGAGTAAATTTTCCCTTACCTTCGTACTAAAATACCGTTATTTGTCAAA
ACGCTGTCATGGAATTCTATAGCACTTGATGCCGGAATGGAGATGCTTATTCTTGTGTTC
TACATTCATGAAGTGCTGATACTATATTTTGTTTTCCCGAACCTCTCCCCTTCTGGGCCC
TTTTTCCATTATTCACAATATTTTCATACCTTTACCTCCGTACACCAATCTTTATTTTTA
CCCCCATACCTTTGTATTCTGAAATTGAGAAATGATTTGTGGTGCTTTTTTTTTTGGACA
ATCTGCCTTCGTGGACAGTTTTGAAACGCTAGGCGACAGTTTTGCAACGGAAGGAAGTGG
GAGAGCCCAGAAAGGCTTTCTCTCGATGGTGGATCATTCTTGCGCAGGCGGAGGATGGGA
AAGCTCCGTTCAGGTTTGCGGCTTTTCTTTCTGGCATTTTCGTTCTCCCAACTGCGCAGG
CAGACATAGCTTGACTTTACTCATGCTCGCATTAGGCGGGTTGAATCTCATAGCTTGAAA
GATAGTATTGAATTATATTGAAGATTTTATAACTAGTGATAATTTCATTCAAGTTTTAAA
GAAAGAATTAATAAGCAAACAGAACTCAATCAAAGGAAAA
Chromosomal Coordinates Chr IV from 322226-322282,322704-322988
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator