Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name IDP1
Systematic Name YDL066W
Description Mitochondrial NADP-specific isocitrate dehydrogenase, catalyzes the oxidation of isocitrate to alpha-ketoglutarate; not required for mitochondrial respiration and may function to divert alpha-ketoglutarate to biosynthetic processes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IDP1	6320137 upstream sequence, from -1000 to -1, size 1000
TCTTTTATCCTGCTATAAAGAAACCATAGAAGAATAGAAGCAAAGGGGTAGTACGTGGCA
CCTCCTAAAGGTAATATTGTACTATTCCTAGTTCACTCAAGGTCTGCCTGTCTTATTCTC
CACATACATTTTCTATAACTCTTTTTTTAAGTTTGTTTTTATTTTAGTTTGACACTACAT
AAATATGTAAAACTATTTTTTCAAATTATACAAATAGAAAATTATGATAAAGGTCAAAAA
GAAAGAAAAGAATGACTTGTCTGTTTTCCTTCCCTACAAACTCTTGCAAAAGTAATCAAT
CGAGGCCAGCACAGAAAAAAAATAAAAGATAAATAAATAGGAATAAGAATATAATGCGAA
AAACAATAGTGGTCAGGTTCGGTCAGTTCTCTTGCTTTTTCCTCTCAGCTAGCTCTGCGT
AGAACTTCTCTCTCTTGTTAATCTTATCCATGTGGAATCCCCACCACCAGTAAGAGGCCA
TGACACCCCCGAGGGAGAACCCGAGGACGATGTCCATGATGACTCTTCTCTTGATCGTAC
CAGTAATTGGAGCAATAGTCATGTCTGTGTAAGTCGCTTGTAGTTAGTAGTTTGCAAATA
TCTTGCTTGCTCTAATTCTCGGTCCTAATTTTCCCTGAAGATAAGAGTCTCTTTCATCGA
TTCTTTTAATACCACAGGAACAAAGCGGGCATCGTGGTAGCGGGCCAATCAGGTTGCAGT
AAATGAAGAGATATAGAGGAGGACTCTGCTAAAGACCATAACAAGGGTCTGCAATGATCT
TGGACTAAATAAAGGTGTCTTACAATCCAAAAGAGCTTGAATCATTCCTTTTATGAGCTA
AATAGCACCGTTTGCACCTTCTGATAACGCTTTACGGGTCACGCGCGGATTTTGACTCAC
ATAATTCCACTTGCCCATATAAAGAGGGACTCATATGATCTTATGAAATCTTCCTTCAAG
CAATTGTGAGACAACAGACGCACAAGGAAGATCGCCCAGC
Chromosomal Coordinates Chr IV from 334835-336121
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator