Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPN4
Systematic Name YDL020C
Alias SON1, UFD5
Description Transcription factor that stimulates expression of proteasome genes; Rpn4p levels are in turn regulated by the 26S proteasome in a negative feedback control mechanism; RPN4 is transcriptionally regulated by various stress responses
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPN4	6320184 upstream sequence, from -1000 to -1, size 1000
TAAAAGAAGAGATCATGATTTGAAAGATTGTGGTGACATTTTTTAACACGCCTTTTTTAT
GCGAGCTTTTTTCCTGGTACTTGTATGTATTTTGAATGTATTTTATTGTACTGAATTGTA
TTTTATTCTACCGCACATTTGTTTCTTTTGGCATATATAGTATGTTTACTTAACAATAGG
GATTTCCTTCAGTTTTCCTAGATGTATCAATTTAGTTATCTTTTCGAACACTTTGGTTAT
GTCACCATGGTCAGATGACCATATTATTTTGAAATCCATATAACCAATTACAAAGCAAGC
AACAAGCGAGTAAATAAAATCGTTAGGCGGTTACCATAACCCTTCGTTACGACGCTAAAG
TGCTATATAATGCCTCCATTACGGCTGCGATAGAACTGTGCCTAAATTAGCGGCAGAGGT
TGAAAACCAATCATCACTAACGTATTCAATATTAATTGTTGAGAAAACCAACTACGGATT
GTTATAGAGATCAAACTATATGCACTGAGAGGACGTTACTTCTTTTTTTACTACCTTTCT
GTTCCTGTAATAACAAGTTCCGTGGAACTCAAAGAAAGGTGCCTCAGCCCGTACGAACCT
TTCCACGGATAATCACGTGATCGCTATTACTAATAGCCGTTTACAGTGATGGTTCTAGAA
AGTTCCGTTTCGGCGAAACTTGTTGAGGAGAGCAATTCTATATAAGGAAAGAATAGTTCG
AAGCCCAATTTGGGGAAAGCCCGGGATGAGCAGCCTAACCCACACGGATAATTTTTTATC
GTTCAAGGAGGAGGATACGTTTTATCTCTAATATAAATTAAAGATAAACCCGAAACTCTT
TTTTCTTCTTGGCGTGGAATATTTAAGGAGTAGATCAGTTCCATTTTGTTCATCCTTTTC
TCCTCAAGGAAGAACTCCGCTTTTTAGTTGAACTAATAGTAGATAGTACTAATAGCTAAT
TTGTATCTTTTCAAAAGTTTTCTAGAATTTTCAAGCAATC
Chromosomal Coordinates Chr IV from 416708-415113
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator