Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name APC11
Systematic Name YDL008W
Description Catalytic core subunit of the Anaphase-Promoting Complex/Cyclosome (APC/C), which is a ubiquitin-protein ligase required for degradation of anaphase inhibitors, including mitotic cyclins, during the metaphase/anaphase transition; contains a RING-H2 domain that is required for activity
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APC11	6320196 upstream sequence, from -1000 to -1, size 1000
CAGGGAATATGCTGCTATGCCGACTTCTACCACGAATAAGGGGAGCTCTGAAGTAGACGA
AGAAATTAATGAAATAAAACAGAAGGTGGGACTCCAACAGCCCATAGCATCGGTTGATGA
TAGTTTGTCGGCCATTAAAAACGATAAAGGGTCGCGAATAACCAAAGCTTTTAATGTTCA
AAAAGAATACTCCCTCATACTAGACTTGTCTCCGATTATAATATTTAGTAAAAGCACCTG
TTCATATAGCAAGGGCATGAAGGAACTGCTTGAAAATGAGTATCAGTTTATCCCAAACTA
CTATATTATAGAACTTGACAAACATGGACATGGGGAAGAGCTGCAAGAATATATCAAGTT
GGTGACCGGTAGAGGAACTGTTCCAAACCTTTTGGTTAATGGAGTATCAAGAGGAGGTAA
TGAAGAAATCAAGAAACTGCACACTCAAGGGAAACTTTTAGAATCATTACAAGTCTGGAG
TGATGGTAAATTCTCGGTTGAGCAACGTGAAAAACCTTCCAATAATTGAAATTGTTACAA
AAAGGAAAGAAGAAAAAATTAAGAATAAATATATAAATAAAGAGGTCGTGAATGATTAGG
TCGTGAAATGCAGTGTAGTTGGAAAGGCGTAGTTTTCCTAGCACAAGGCGTTTCGGAGTT
GGAATAAAGAAGCTATCACCAACGAAGAAGCTTTTTTGTCCAAGACATCTCTTAAAAGGG
TTGTGAAAACATAAAACGCTTAATGCCTTCATATATACATATATAAGTTTATGGTTTCGA
TGTTTACAATAACTTCTATCCTTTGCTGGTCCATGCACTTCACCTTGGTAAGTTATGCAA
CGCACTTTTGTCTACGCCTGCATTCGATATAAAGGGTAAGCTGCCGAGATAACTTTTGTA
TCTTCCGTGTCTGCAGATAAAAAAATAATGCATTCTTCAAAAACTTTGTACAATATCGGG
AGAGTTTAACAAGCAAAGTGGCAATACAGATTATAAAAAT
Chromosomal Coordinates Chr IV from 433497-433994
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator