Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MCD1
Systematic Name YDL003W
Alias PDS3, RHC21, SCC1
Description Essential subunit of the cohesin complex required for sister chromatid cohesion in mitosis and meiosis; apoptosis induces cleavage and translocation of a C-terminal fragment to mitochondria; expression peaks in S phase
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MCD1	6320201 upstream sequence, from -1000 to -1, size 1000
TACAGAAAATTTTATTATTTTATATTCAAAAACAAGAAAACAAAAGAGAAAACATTAACA
TGTAATTTTCATAACTAATAGTCCTAGAAAGTAATACTTTTTACAACTGTTTCTTTAAAT
CCTGTATGAAAGCCCTAGTTGCAGATCATCGTGTTATTCCAGTGAGTTTTCACTTCCCTA
AGTCCTTCCTATTTATGTTTTAGTCCTTCTTGCACAGCAATTTTACTTCGGGCACTGTTG
CCGTATATTCTAAAAAAATGAAAAAAACGTTCATGCCCCAGCGAAAACCAGTGTTTCCTC
GTATTCGTGTCAGTAATTACACCAAAGTTTGTTCTACACTAAATCACGAATAAAGTGGGA
GATTGAGTTCAACAAAATATCTGATTATAAAAGTATGAGAACAAGAAAATTAAGGAGCCT
CCATAATAAGGTGCTTTTAATTGAGAATGAATGTTCATTAGTTGCTATATTGATGGTGAT
GGAACTCCAATTACCTAATCAAAAATATGAATGTTTATGCGAATAAGAGTTTGTAAAGAA
AAAGATCCCTGTAGACTGGATGTGAGATGATGATTTCATTCCCGGCCTCTTAAATAAAAA
CAATTACCACTGCAAAAATGTTCTTCAAACGCGTTTATTATATAATGAAAAAGAAATTCA
AATTTTTCGCGTTTGAAAATTTATGCTAAACAAATAACTCGAGGAGGGACGCGTCGAGAA
AATCGCGTCTTTCTACTCTCACAGTGCTTGCATACGTATGGTATACAGTATCAAAAGTAG
CAGAATTTGTCTTCATTATGATATATATATATATATGTACATATATATAGGGTGCTAAAA
AGTATTCTTTTTGCTATTATTATTGCTTAAATCGCCGACCTTTTTCCCATTGTCACGAGA
ACATAATTGTTAAACCAATAAAAGGAAAATCCATAACAAAAAAGGACTGGTCAAAGAAAA
GACAACTCAATTGCACAATTACTTTACAAGAAACACGACA
Chromosomal Coordinates Chr IV from 444683-446383
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator