Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MATALPHA2
Systematic Name YCR039C
Alias ALPHA2
Description Homeobox-domain protein that, with Mcm1p, represses a-specific genes in haploids; acts with A1p to repress transcription of haploid-specific genes in diploids; one of two genes encoded by the MATalpha mating type cassette
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MATALPHA2	6319887 upstream sequence, from -1000 to -1, size 1000
ATTGATTGTTTGCTTGAGTCTGAGTAATATCATATTTTATACAAATACATAGACATAAAC
AAAAGAGGCAAGTAGATAAGGGTATAGCCATATGAGTGTATAAACAAACATTGGGAACAA
GAGCAAGACGATGGGGAGTTTCAAATAGGATAGCTATACTGACAACATTCAGTACTCGAA
AGATAAACAACCTCCGCCACGACCACACTCTATAAGGCCAAATGTACAAACACATCTTCC
CAATATCCGTCACCACGTACTTCAGCATAATTATTCGTCAACCACTCTACAAAACCAAAA
CCAGGGTTTATAAAATTATACTGTTGCGCGAAGTAGTCCCATATTCCGTGCTGCATTTTG
TCCGCGTGCCATTCTTCAGCGAGCAGAGAAGACAAGACATTTTGTTTTACACCGGAGCCA
AACTGTGAGTAATATGCTCTAAAAGCCATAAATGAGTTTAAATATTTCTTTGAAGATTTT
ATAGATGTCTTATTGAACTGTCGAAACTGAGTATTTTGACTTCCAGACGCTATCCTGTGA
ATTTGGATTTTATTTAAAAATCGAGAGGAAGGAACAGGAATCTGGATATCTTTCTTGAGT
GGTCGAATAATATTGAAGCAGCTTGGCCTCACATGCTCAGCTAGACGTTTTTCTTTCAGC
TTTTTTGAAACCGCTGTGTTTCTGTATGATTTGGATGCTTTGTTCTTAATTTTGAAAGCA
GGCTTCGAAGTAAACATATTGTGAATGTCGTCTATTAAGTTATTATATATGGTTGATACA
TTTCATAAAAAGTGAAGGTTAAAAGAAGTAGTTAAGAGTTTAAGTTGTTTCATATGATGT
ACTTTTCTACATTGGGAAGCAATAAATTGCATCCCAAACAAAACCCAGACATCATTAATG
TTTTGAAACATAAAATGTTGGAACTTAAAAATATATATAAAGGAGAGATTGAAATCAGCT
TAGAAGTGGGCAAGAAAAAAAGGAAGATAAGCAAGAAAAA
Chromosomal Coordinates Chr III from 200178-199546
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator