Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GLK1
Systematic Name YCL040W
Alias HOR3
Description Glucokinase, catalyzes the phosphorylation of glucose at C6 in the first irreversible step of glucose metabolism; one of three glucose phosphorylating enzymes; expression regulated by non-fermentable carbon sources
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLK1	6319809 upstream sequence, from -1000 to -1, size 1000
GGCAGTTCTAGGTCCCTCGTAATCGATCGAGTTGTTAACATCGCTGTTTTTGAAAATCTT
CAAGCTTGGGAACCCTGGAATGTTGTGTTCCATACACAGATCCTGGTTTTCAGTACAGTC
GATCTGGGCCAAGGTAATGTTTTTCTCAACTAAAGTCTCGGCGGCTTTAACGTATTCAGG
AGCCATGTTCTTACAGTGGCCACACCATGGAGCAAAAAACTCCGCAAGCACCAAGTCGTG
CGACTGAATGTACTCATTGAAGGAGTCGGTGGCCAACTTAACGACAGCGGAGTCTTCAGG
GGCCACAGCCTCTTGTTGGGCGAAAACAGAGGAGGCGAGCAGCAGGGAGGACCATGACAG
GACGGCACCAGCAGAAAACTTCATAACGGGATAGATGTATGTTTTTCTTTATGTAGAGCT
TGGCAGCTTTAAAATTACCAATTAGACATGCTGCTTGCAACAAGAAAATGCACGCGTAAC
AAAATATATATATATATATATATATATATGTATGTCCATACGGGTTTTTCGTTTTGTTGT
GGTTGTAACAGCACAACAAAATGCTACACGGTGGCAAATTGGAAAAAGAGACTAGTGAGA
GAAAAGGGAAAAAGAGGCGCCGCCCGACAGGGTAACATATTATCACGTGCAGCCCAGGAT
AATTTTCAGGACACGTGTTTCGAAAGGTTTGTCGCTCCGAAAAAATCAAAAAAAACAAAA
AACGGGAAATAACAATAACGACAAAAATGGAAAAAAAAAAAATTTTAGACGCGGCGCTTG
CACCCCGCATTATAAGTGGTGTGCCGACGGACGGTCAACCCCTTTCAGGGGGCCCCCTAT
CTTGGGCGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAACGCGCCCATATA
AATATCCGCTATCAACAGAACCCCCAACCCCCCCATCAGTGCCCAACTCAGCTTCCGTAA
ACCACAACACCACCACTAATACAACTCTATCATACACAAG
Chromosomal Coordinates Chr III from 50838-52340
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator