Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name COS2
Systematic Name YBR302C
Description Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically-encoded proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COS2	6319779 upstream sequence, from -1000 to -1, size 1000
AATTTATATACACTTATGCCAATATTACAAAAAAATCACCACTAAAATCACCTAAACATA
AAAATATTCTATCCTTCAACCATAATACATAAACACACTTAATTGCGTCTTAATACTATC
ATGGTATCATTAACTTAAAGTTCCTTAATATCGTCATACCACTATGCTCTATTCCATATA
TTGTAATATAACTGTACTCTATAGTCATACAGACGCTTTTACTTCACCCCATCTTATACT
ATTGTCATAGAATCTCACACTGACGCATGATTAAAACGAATAATTTTTACTGTAAGGGCT
GCCATCCGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAATCTCAAAACAAGCGG
GAGAAGTGCTAATTACCCAGAGGTCATGCATGATCTGAGTACCACCGTACCTCTAGGTTT
TGCTTTGATCCGTTTTACAGTGACACCGAACATAAGGGGAAGCTATTGACATGGTATCGA
AAGGTTGTCCACATTGGGAAGTAACTTGGTTCTATGAATCTTCATGTCAGATACGTAGGA
CAGACTCTTTCCTGTGTAAATATTTGTGACAGCTACGTCTATTTTCTACTAGATGTTTAC
ACAGTTTTGTCACAGGAAATCTACGCTTAAAATATGTATTTCATTCAAGCGGTAACCGCT
GTACGAGCAGTGACATTGCTGGTCGCACCCTAAATGTGAACCAACGTTACGGCACACCGT
GATGTACCCGCATTAAAGTTTTGTAAATTCGTTATTACGATTATCGAGTTGGCTAGATAG
AAAACCGGAAATGTAATGGATGCCCTTTTCGAATAGCTGAGTTTCTTTGCCTAAAATAGC
CCAATATTGTTGCCCTTTTTCTATCACGAGGTTACTGAGCCATTGCATGAACGCGCGCGC
CTCGGCGGCTTTTTTTTTCTGCTGTGCTGTATAAAAGCGAAAAGCCAGAAGTTACTATCT
CGAATAAAAAACCCCTCGAACTGCCATCTCACTACCGAAA
Chromosomal Coordinates Chr II from 811479-810340
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator