Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PAF1
Systematic Name YBR279W
Description Component of the Paf1p complex; binds to and modulates the activity of RNA polymerases I and II; required for expression of a subset of genes, including cell cycle-regulated genes; homolog of human PD2/hPAF1; involved in transcription elongation as demonstrated by the G-less-based run-on (GLRO) assay
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAF1	6319756 upstream sequence, from -1000 to -1, size 1000
ATAAAAACAAGCAAGGGTCAACCGTGTTGCAAAAAAAATGTCCAACTTAGTTAAAGAAAA
AGCACCTGTCTTTCCTATATCTAAAGTAAAGAAGATTGCCAAATGCGACCCCGAATACGT
AATTACATCTAATGTAGCTATATCAGCGACCGCATTCGCTGCTGAGTTATTTGTACAGAA
TCTCGTCGAAGAATCGCTGGTCTTAGCACAACTGAATTCGAAAGGAAAGACAAGCCTACG
ATTAAGCCTAAATTCTATAGAAGAATGTGTCGAAAAAAGAGATAATTTCAGGTTTCTAGA
GGATGCCATTAAACAACTGAAGAAGAATAGCGCACTCGACAAGAAGAGAGAACTAAACAT
GCAACCGGGTCGGAGCGATCAAGAGGTTGTTATAGAAGAGCCTGAATTGCATGAGGATGA
TGGTGTAGAGGAAGAAGAAGAAGAAGACGAGGTATCCGAAGAAGAAGAGCCCGTACACAA
TGAAGAACTTCTTGATGATAGTAAAGATCAACAAAATGATAAATCCACGCGCAGTGTGGC
AAGCTTGCTGTCGAGATTCCAGTATAAATCCGCACTAGACGTAGGAGAACACTCCGACTC
TTCTGATATCGAAGTTGACCATACGAAAAGCACCGATCCTTAGTGTTGTTGCTATTATTG
CTATGTAATTACTATTCGATGCAATATGTTATACATATACATACACGCAATGAGAACCCT
AACCTTGAACTTACTATTTTAAAAGGACATCTCGAAAAAGCTTAGGGATAATTAATATTT
TGTAGGTTAGAGCTGTTATGTAGGGAAGAAAAACAAGGGCTTTAAAATAATAATCACATT
ACACGAATAACTTAATTTGTCTTTCTGAAATGGAAAAAGAAAAAAATGACGACTGTAACA
TTGGATGAATTAATACTGTCATTATTGATACGTTGTTAATTATAGACAGAAATGTATTCA
GTACAATAGAACAGTGCTCATAATAGTATAAAGGGTCACA
Chromosomal Coordinates Chr II from 761257-762594
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator