Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DPB3
Systematic Name YBR278W
Description Third-largest subunit of DNA polymerase II (DNA polymerase epsilon), required to maintain fidelity of chromosomal replication and also for inheritance of telomeric silencing; mRNA abundance peaks at the G1/S boundary of the cell cycle
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DPB3	6319754 upstream sequence, from -1000 to -1, size 1000
TACATAACCCTTTTGAACAAACATTAAACAGATCTGTAAAAGTAGTGCAAGGGTTGTACA
ATTGGGGCAATTTCCCTCGTGTGAGCACGCTGGCGCTGATTCTGTTTGCATATCAGTGCT
GCCACCAGTCCGCGAACAATAAATTACTATATTATCAACCATTTCTATCATCTTGGCACA
TTGCAGGTCGAACCTTCGGAATAGACCTCTCCTTCCCCAGACGTCCTGCCCACTCCGTTT
TAGCGTGGTATTAGACCCAACCTTGTTTCTAGAATACCTTTTAAGTTCTAATGATAGTCC
ACGAGGATCTACTTTCAGAAATGGTAAAATGCTATGATTGTGACAATAAGTAGCAGCGTT
TTCCAAAGCAACATCATCCACTTGCAATTCCAATTGTCGTATCTGAAACTTTAGCAAGTT
CAAAAGTTCCTTTGTGTTATTGGGATATTGAAAACCATTAGAATCATTTCCAGTTTCACA
GGTATCGCCCTCTCTATGAAAGGAAGTGCGAACTTTCCAGGACTGGAAGATATCATTCAC
TTCGAGAGAATTACGCAAAAGCGCAGAATTGTTAGCATCTGATTGCGATTTGACTATTGC
AAGAGAATGAGGAAAATCGGGTGGTTGACCAAAGGAAATATCATGAGCCCAGGGGAACAT
TTTTTTACATTCAGGCCATTCTGCATCCTGATGTAGTCGCATAAGATCATGCAGTTCACC
AGGTGTGATTGAGGGCACTTCCAAAACCATGGTTGTTGCTCTAGTTTTCTATACCCGCCC
CTTCTACCTCAATGACAATCTCTCTTTTATGGTTGGTGTTTCTTTTCACTTTTTTACTTC
TTCTTGTACTTTTCTTTTTGAACCTTAAAAACTCTTGCAATTATGTTTCCATGATGCTTT
TGAAGTAATAATTTATTTTTATTACGCGAAATTAATGGCCTTAACAACTGCCTGCCCCAA
CAGATAAAAACAAGCAAGGGTCAACCGTGTTGCAAAAAAA
Chromosomal Coordinates Chr II from 760294-760899
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator