Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DUR1,2
Systematic Name YBR208C
Alias DUR80
Description Urea amidolyase, contains both urea carboxylase and allophanate hydrolase activities, degrades urea to CO2 and NH3; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DUR1,2	6319685 upstream sequence, from -1000 to -1, size 1000
AAAATAAAGGTCCCCGCTGAAACTTCTTTGCATACAGTTCAAATATTCCACCGTTCTCTT
ATATGTGGGGCTGGCACTACTTCGTATAATTGACTATACTATCTATATTAGTCTTCCCAC
ATGTAATAGAAAGCTCGTATGGCGCAGTGGTAGCGCAGCAGATTGCAAATCTGTTGGTCC
TTAGTTCGATCCTGAGTGCGAGCTTCTTTTTTTTTTTGCAATCCTTATTGAACTTTTTTT
CTTGCTGCAGTCTCCTCAAAGGCAACATGTTCTTTGCTTTTTTTCCCCAACGACGTCGAA
CACATTAGTCCTATGGCTTGCTGCAGATAAGGCTACTATGTGTATTGGCAATACCCTTTT
TAAAATTGGCAGATCTCTTATGGCGATCGCCGAACGCCAGGTTGTTAGCTAACTGCAACG
GCACGCATCTTTGGCTGCATTTCGCCTCATCATTTACGCGCTTTTCCAGGCTTTTTCCCC
TTATCAGATAAGATAAAAAAACGAACAATAAATAAGCTTCAGATAAGATAAGCAGGAAAG
CGTTCCTAGCCCTACCGAGAAATGTGCGTTTATAGTTTGGTGCCTCTTTCTTGATTGACG
CTCTATAATGAAACCAATATGCGTTCATTCCCCTATTTCATAGGGCACTCTGTTCGCAGT
TAGCGCAAGCCATTGAGATAAGACACGCAGATGTTTTGCTTTTTCCTGCTTCTTAATTTG
AATCGAGCTTTGTTAGACGTTGTTGGAAATTGAATGTTTGTATTTAAACACTAGAGCAGA
TGAGGTGTGAGATTTGTATACTCGCTCACTTCTGAATATCAGGCTCTCTTAGCTAAGCTT
TTTTTTTCTAGGATCATATAGGCTCAAGTTTTTATAAGCTTATATTAATATATCAGTGGA
GCAGCTGATATACACCAAATTTCAATTTACATTAATATAAAAGATAAAAAATAGAAATAT
CTTTTTTATAGTCACAATAAATTTCAGTTTTGATTAAAAA
Chromosomal Coordinates Chr II from 642210-636703
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator