Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DUR1,2
Systematic Name YBR208C
Alias DUR80
Strain S288c
Description Urea amidolyase, contains both urea carboxylase and allophanate hydrolase activities, degrades urea to CO2 and NH3; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DUR1,2 YBR208C
AAAATAAAGGTCCCCGCTGAAACTTCTTTGCATACAGTTCAAATATTCCACCGTTCTCTT
ATATGTGGGGCTGGCACTACTTCGTATAATTGACTATACTATCTATATTAGTCTTCCCAC
ATGTAATAGAAAGCTCGTATGGCGCAGTGGTAGCGCAGCAGATTGCAAATCTGTTGGTCC
TTAGTTCGATCCTGAGTGCGAGCTTCTTTTTTTTTTTGCAATCCTTATTGAACTTTTTTT
CTTGCTGCAGTCTCCTCAAAGGCAACATGTTCTTTGCTTTTTTTCCCCAACGACGTCGAA
CACATTAGTCCTATGGCTTGCTGCAGATAAGGCTACTATGTGTATTGGCAATACCCTTTT
TAAAATTGGCAGATCTCTTATGGCGATCGCCGAACGCCAGGTTGTTAGCTAACTGCAACG
GCACGCATCTTTGGCTGCATTTCGCCTCATCATTTACGCGCTTTTCCAGGCTTTTTCCCC
TTATCAGATAAGATAAAAAAACGAACAATAAATAAGCTTCAGATAAGATAAGCAGGAAAG
CGTTCCTAGCCCTACCGAGAAATGTGCGTTTATAGTTTGGTGCCTCTTTCTTGATTGACG
CTCTATAATGAAACCAATATGCGTTCATTCCCCTATTTCATAGGGCACTCTGTTCGCAGT
TAGCGCAAGCCATTGAGATAAGACACGCAGATGTTTTGCTTTTTCCTGCTTCTTAATTTG
AATCGAGCTTTGTTAGACGTTGTTGGAAATTGAATGTTTGTATTTAAACACTAGAGCAGA
TGAGGTGTGAGATTTGTATACTCGCTCACTTCTGAATATCAGGCTCTCTTAGCTAAGCTT
TTTTTTTCTAGGATCATATAGGCTCAAGTTTTTATAAGCTTATATTAATATATCAGTGGA
GCAGCTGATATACACCAAATTTCAATTTACATTAATATAAAAGATAAAAAATAGAAATAT
CTTTTTTATAGTCACAATAAATTTCAGTTTTGATTAAAAA
Chr coordinates Chr II from 642210-636703
w3c xhtml validator w3c css validator