Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MED8
Systematic Name YBR193C
Description Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MED8	6319670 upstream sequence, from -1000 to -1, size 1000
TATTTACCCATGGTGGTCATATGCTCGGTGTGAACGACATTTCGTGGGACGCTCATGACC
CTTGGTTAATGTGCAGTGTGGCAAATGATAATTCAGTTCACATATGGAAACCTGCAGGAA
ACCTTGTTGGACATTCGTGACCTAAACGTTCCTTGAAGCCAGGCATGCTAATGGCTCCTG
TCCCTATTACATATTCAACCATTTGATAGACGAATATACAAACATAAATAGAGTTTATAA
AATATGCTCAAGACTTGCTACAATAAACACTACGCTCAGACTTCATGCTGATTTCAATAT
TGTATTTCGAAGAAAGTGGTTGCTCATTTATTACCTTTGAACTTTCACTTTGGTATTTTG
ATATTCTCGAGGTTTCCCAGTCTGGCTTGAACTTCAGTTCGCCTTTTGAAAGTGGCAGGA
TTATAAGGTATATTTCTGTAATGTGATGGTGCAGTGCCTCTTGGATTCCAGTCTTTATCG
TAAAATATACTTCTTATACCGAGTTCACCGTTCTCTTTTTCACGACCCAGTGAGTGTCCA
GAATCAGCTTCTAAATGACCTTTTGATACAGTCTGCAGAAGCTGTCCCTCTTTATTTCTC
TCTAGGTTTCTAGAAAGTGATTCAACTTGATTTCGTACCTTTTTCTTATTTGGGCGTTGG
ACCTTGGAAACCCTTCTTTCTGTTAAGTTATTACTTGGGTCCTTCTTTTGATCCATTAAG
CTCAAACGTATATAGTATAAAATGATGGAATGCGAGAACTAAAAGGATTGGATGACTTTG
AAGGTAATATATTTCCTTGATATTTGAAAATAATCAAAAAAATTTGCTGAAGGCCTTTGC
AAAGTGTCTAAAAGTACGTTCTGTTCAAAAAAGTAAGGAAACTCAATATACAAAAATTGC
CTTTTCGTCAAAGTTAAGGATTTTAATATTGAAATATTTCATCGATATAAGAGAACCCCG
AGCAAGAAGAACAAAAGAAAAACATAAAGCAACGTGGAAT
Chromosomal Coordinates Chr II from 609753-609082
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator