Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPS9b
Systematic Name YBR189W
Alias RPS13A, SUP46
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps9Ap and has similarity to E. coli S4 and rat S9 ribosomal proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS9B	6319666 upstream sequence, from -1000 to -1, size 1000
TCTCTTTTTTCTCTTCATATTTAAGTGTGAATCTTGAAAAGAATATTTATAGACATACGT
AACTAGTGTACGGCTGATATTTATTTGATGTAGCTTTTTTTTTTGCTAAGTTCATCGCTT
TTCTTTCCCAGCCAACCCAATGAAGTCTTGCGCACGCAATTGGTTGTAATTATCCGATCA
GCCGCTATCATCATTGTCACGGTCGGGTTCCTGTAATACCCTTTTCCTTATTATTCCCTT
AATTTTTTCATTCGTTTTCTTCTCGAGCACTTCCATAATAGGCGCTAATTTGGCTTTGAG
ATCGCTGGTTTCGCAAACCTTATCGATGTAACGCTGATGTTCGTTTTTTTGGGGGATAAT
ATATGGCTGACCACTCTCTTTTTGTTTCGTCTTCTGAATAGTTTCTTGTACAAAACTATT
CGTTGCGTTAGAGCTCTGTCCTGTTTGAATCACCGTGTCATATACAGGTTCATTTGAAAT
ATTTAAACCAACAAAATCATTGGCTTCTTCTTTGCCTGTTTTGCCCAGCTGGTTGATACG
GGCACGTAACTGATTTAATTCTTGGTCCCTTTCTAGTGATAAATCTCGCAGAGAGGGCAT
ACTGGTTGTAAAAAGTAGTCGCAACAAGTAAGTCGTAAAAAAGTAGATGTAATGGAAGGC
TTTGAAGGAACGGCTAGCCAGCTTTTCTGTATCATTCCTAGCCTAATTGACAGCATCTTG
ACCTTCTAGTATGGAAACTTTCAATTTCAGAAAGCGGTGTTCCCCGCTGCGACGATTTAA
TCCGTACATTTACACATCTGTACATTTTTCATATTCGCAAAACAAAGGTTACTTGAAAAA
ATCATAAAGTTGGCGGCTTCAGGTGGACGCGCTTCACTCATGTAGCTTAACATTCAATCC
CATTAAGCATTATGCATAAATTTCATGAAGTTTACTTAATAAAATTGTTCATTTGCATAG
ACAAGAAAGAAAGCAACAAGACAACTAAGACTAAGCAACA
Chromosomal Coordinates Chr II from 604508-604514,604928-605508
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator