Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name CDC28
Systematic Name YBR160W
Alias CDK1, HSL5, SRM5
Description Catalytic subunit of the main cell cycle cyclin-dependent kinase (CDK); alternately associates with G1 cyclins (CLNs) and G2/M cyclins (CLBs) which direct the CDK to specific substrates
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC28	6319636 upstream sequence, from -1000 to -1, size 1000
ATTAAGGAATTGTGTGCGCAGTTACCAATCACCGTTTTGGTCAATAATGTTGGTCAATCA
CACTCCATTCCTGTTCCATTTTTGGAAACAGAAGAGAAGGAGCTTAGAAATATTATCACT
ATCAATAACACTGCTACATTATTAATTACACAAATCATTGCACCAAAGATTGTGGAAACT
GTGAAAGCTGAAAACAAGAAGTCGGGTACTCGTGGTTTGATCTTAACCATGGGCTCATTT
GGTGGTCTGATTCCCACCCCACTTTTGGCTACATACAGTGGTTCGAAATCATTCTTACAA
GGTTGGTCTAACTCTTTGGCTGGGGAATTATCTAAAGATGCTATCGATGTTGAATTAATC
ATTTCATATTTGGTCACTAGCTCGATGTCTAAAATCAGAAGATCATCTTTAATGATCCCA
AATCCACAACAGTTTGTAAAATCCACTTTAAGAAGCGTTGGCAGACGCTGCGGCTCTCAA
GAAAGATACGCTACTATGACCCCTTACTGGGCGCACGCAGTGTATCAATTTGTAATTACA
GAGACCTTTGGCGTTTACTCTAAGATTGTTAACTCCATTAATTATTCCTTCCATAAATCT
ATCAGAATTAGAGCCTTAAAAAAAGCCGCAAGACAGGTTAAAAAGGAATAGAATTATCGT
TCTCGAGATAGTTTTTATACAATACATATATATATATATATATATATATTTACAAGAAAA
GCATGGCTTATGTATTATACTTGCTTATGTACCAATATATACATATATGGCCTTATTAGG
GCAACAAACGCCAAAAATAAAAACGAACCTAAATGAGAAAAAAAGAGAAAAATTTGGAAA
ACAACAAGAACTCAAAAAAAAAAATTGGTGGAAGGACCAAGTCCTCTTGAAAGAAAATTT
AATACTGCTTTTCCAGAATATCATATTGGAAAAAATATTCAAGCCAGCACATCAGCTACA
GTGGAAAATAGCCCAGATCAAATAGAACTATCCTTCGAAC
Chromosomal Coordinates Chr II from 560078-560974
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator