Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name AAC3
Systematic Name YBR085W
Alias ANC3
Description Mitochondrial inner membrane ADP/ATP translocator, exchanges cytosolic ADP for mitochondrially synthesized ATP; expressed under anaerobic conditions; similar to Pet9p and Aac1p; has roles in maintenance of viability and in respiration
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AAC3	6319560 upstream sequence, from -1000 to -1, size 1000
TAAACTGCACAGAAAAAAAATTCTTCCACAAGTTTCCTCTTTTGCCTTTTAGTGCTAAAA
CTCCGATTATAGAAACATCTGGCTTCACTAGCATATTCATGATGCAAATGGAACACAGTA
TCGTTCTTGGCATATATTACCCATATCACTTTTCAATAACGCTGGTGTTTCAGGTGATAA
CTCATCAAACTCGCATTCCTCAAGAGGGAGTTATTATAACAATTCTATCTTATTCCTGAT
AAACTTTCATAGATTCATTATTCACTGCATCACATACATTTTTGCTTTGGAGTTCTTAAT
CAACTTTCTATGTGAAGCGTAAAATCAATAGTTACCTTGTATTCTCTGTTGATCACTGTC
CAAACCTATATTTTTGTTTCCCCCTCAGAGAAGTTAGGTCGATGCCTATCGTAGTTTGCA
AGGAAGACGGCTTCCAACTGAGACCGCCCTAGTCTGGCAGGATTCGTGAAAGGAGTCCAT
GCCAGCTGCTACCCAGGGATTGCCACGGCCCCGGCCAGCGTATAGTACACTGTCAGGAGC
AATTCGAAGAGGCAACCAAAATTATGCTAAGCATCGCACTCTCTCTCAGTCTGGTGCTAA
GCGGAAGACATGCTTCCAATGGCCTCCTCACCGAGAACGGATATTAAACGAAACGAAGAA
AAAAAATCTTCACGGAAAATGCGTAATGTCTGGATGACAAAATGCATGGGTGTAAAAAAG
GAAATGAGACGAACTTGTAATAAACCTTAGTGGGTTGACGAATTTTGAAATAAAGTTTTT
CCTTTTTTTTTTTTTTTTTCTTTTTCATTGTTTGGTTGCCTTCAAATTACATATAAGATT
TCTCGAGAAGGGTTTTCCATTGTCCTTTTCATTAGGCGTTGAAGTGAATCTAAAGTGCGC
TTGAATGATTTCAGATAGAAAGACTAAAGAAGTGGTGTGAGTATAATTAACTCAATTGAA
GACGGTTTACCTGAAGTGATATACTGTGCCTTGAGAAACA
Chromosomal Coordinates Chr II from 415983-416906
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator