Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL19a
Systematic Name YBR084C-A
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl19Bp and has similarity to rat L19 ribosomal protein; rpl19a and rpl19b single null mutations result in slow growth, while the double null mutation is lethal
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL19A	6319559 upstream sequence, from -1000 to -1, size 1000
GTTCAAAGCTTGAGTGGGAAAATAACGAATAACATTGGCAGTATTTCCTCGCCAAAAGGA
TATTAGTCCCTCTTGCTTTGCAGTTCTCTTGAAACAATCCACGATACCGGAATACTTTTT
ATCTAAAGTTCCTTGCTTGATCATTTCATCTTGATTTTGGATCAAGATCTTGACTCTTTC
GATTGGTGAGGCAGCAGTTTTAGCGATGGCCGCACTCACACCACCCATTAAGAAATTAAT
GGCAAAGTTTGTTTCTTGTTGCTTAGCGTCGCTACTCATTGTTTCTCAAGGCACAGTATA
TCACTTCAGGTAAACCGTCTTCAATTGAGTTAATTATACTCACACCACTTCTTTAGTCTT
TCTATCTGAAATCATTCAAGCGCACTTTAGATTCACTTCAACGCCTAATGAAAAGGACAA
TGGAAAACCCTTCTCGAGAAATCTTATATGTAATTTGAAGGCAACCAAACAATGAAAAAG
AAAAAAAAAAAAAAAAAGGAAAAACTTTATTTCAAAATTCGTCAACCCACTAAGGTTTAT
TACAAGTTCGTCTCATTTCCTTTTTTACACCCATGCATTTTGTCATCCAGACATTACGCA
TTTTCCGTGAAGATTTTTTTTCTTCGTTTCGTTTAATATCCGTTCTCGGTGAGGAGGCCA
TTGGAAGCATGTCTTCCGCTTAGCACCAGACTGAGAGAGAGTGCGATGCTTAGCATAATT
TTGGTTGCCTCTTCGAATTGCTCCTGACAGTGTACTATACGCTGGCCGGGGCCGTGGCAA
TCCCTGGGTAGCAGCTGGCATGGACTCCTTTCACGAATCCTGCCAGACTAGGGCGGTCTC
AGTTGGAAGCCGTCTTCCTTGCAAACTACGATAGGCATCGACCTAACTTCTCTGAGGGGG
AAACAAAAATATAGGTTTGGACAGTGATCAACAGAGAATACAAGGTAACTATTGATTTTA
CGCTTCACATAGAAAGTTGATTAAGAACTCCAAAGCAAAA
Chromosomal Coordinates Chr II from 414753-414186,415261-415260
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator