Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SEC18
Systematic Name YBR080C
Alias ANU4
Description ATPase required for vesicular transport between ER and Golgi, the 'priming' step in homotypic vacuole fusion, autophagy, and protein secretion; releases Sec17p from SNAP complexes; has similarity to mammalian NSF
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC18	6319554 upstream sequence, from -1000 to -1, size 1000
TTAGAGAGCTTGGATTAGAAAAGGAGTTTGGAGTTTTGAGTTCATCTGTTCCATTACAGT
TACTGACTACTCAGTTTCAAACTGTTGACGGGGAAACCAAAGTGCAGGCCAAAAAGATCC
AACCGGAAGAATCAGACAGCATTGTGTATAAGAAAATTACAAAAGGTATGCTGGATGCTG
GTTCATTCTGGAATACTCTACTTCCCCTATTACAAAAAGATTATGAACGTTCCAAGGCCT
ATATAGCAAAGCAAAGCAAGTCATCTGCAAATGATAAAACCTCAATGACTTCCACAGAAG
ACAATTCTTTCGCTTTACTAGAAGAGGATCAGTTTGTCTCAAAGAAAACCGCAACGAAGG
CAAGATTACCTCCTACTGGTAAGATAAGTACCACATACAAAAAGAAACCGATCGCAAGCG
CGTTTATACTTCCAGAAGAAGACTTGGAAAACGACGTAAAAGCGGATCCAACAACAACTG
TAAACGCCAAAGTGGGTGCAGAAAATGATGGAGATTCTTCCTTATTTTTGCGAACGCCTC
AACCTTTAGATCCTTTGGATATGGATGATGCTTTTGATGATACCAATATGGGCAGCAATA
GTTCATTTAGCTTGAGCCTTCCTCGCCTTAATCAATAATGAGCGCGCTAAATAGTTGAAT
ATTTTATCTTTAATTAAATACATTTGCTTATAAAGGTTGTACTATTTACTTGTAGTTGAT
GTAGGATTCCAATTCAATGCACTTTAATACTCAGAGTACGCTTTATACTTCTGCAGTACC
CTCTCTAAAATGTCACCTAGTATTTTTTTCTCTTTACACAAGCGTAGCGTCACTAAAAAA
AGGTATTTCCCATGGGTTAATTCGGTATCACACTATACGTTAGGCGTACCAAATTTCGAG
ATTCATGAAATTGGCTTATTCGTAGCCTTTAAGTACTACCGTTGTTTCTCTCAAAGATAA
GAGCAAATAGTACCGTATATTCAGCCTTTATAAATTGAGT
Chromosomal Coordinates Chr II from 400890-398614
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator